Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:2.7.1.21 (
thymidine kinase
)
7,561
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Expression of
prostate-specific antigen
(PA) mRNA was tested at various time periods after incubation of the human prostate tumor cell line LNCaP with the synthetic androgen R1881. Androgen-stimulated expression was observed within 6 h after addition of R1881 to the cells. Run-on experiments with nuclei isolated from LNCaP cells showed that expression of the PA gene could be regulated by R1881 on the level of transcription. DNase I footprints of the promoter region of the PA gene (-320 to +12) with nuclear protein extracts from LNCaP cells showed at least four protected regions. The protected areas include the TATA-box, a GC-box sequence, and a sequence AGAACAgcaAGTGCT at position -170 to -156, which closely resembles the reverse complement of the consensus sequence GGTACAnnnTGTTCT for binding of the glucocorticoid receptor and the progesterone receptor. Fragments of the PA promoter region were cloned in front of the chloramphenicol acetyltransferase (CAT) reporter gene and cotransfected with an androgen receptor expression plasmid into COS cells in a transient expression assay. CAT activity of COS cells grown in the presence of 1 nM R1881 was compared to untreated controls. A 110-fold induction of CAT activity was found if a -1600 to +12 PA promoter fragment was used in the construct. By further deletion mapping of the PA promoter a minimal region (-320 to -155) was identified as being essential for androgen-regulated gene expression. Mutation of the sequence AGAACAgcaAGTGCT (at -170 to -156) to AAAAAAgcaAGTGCT almost completely abolished androgen inducibility of the reporter gene constructs. One or more copies of the sequence AGAACAgcaAGTGCT cloned in front of a
thymidine kinase
promoter-CAT reporter gene confers androgen regulation to the reporter gene. These findings provide strong evidence for transcription regulation of the PA gene by androgens via the sequence AGAACAgcaAGTGCT. Interestingly, in addition to the AGAACAgcaAGTGCT element, an upstream region (-539 to -320) is needed for optimal androgen inducibility of the PA promoter.
...
PMID:The promoter of the prostate-specific antigen gene contains a functional androgen responsive element. 172 87
Transcription of the
prostate-specific antigen
(
PSA
) gene is androgen regulated. The
PSA
promoter contains at position -170 the sequence AGAACAgcaAGTGCT, which is closely related to the ARE (androgen response element) consensus sequence GGTACAnnnTGTTCT. This sequence is a high affinity androgen receptor (AR) binding site and acts as a functional ARE in transfected LNCaP cells. A 35-base pair segment starting at -400 (ARR: androgen response region; GTGGTGCAGGGATCAGGGAGTCTCACAATCTCCTG) cooperates with the ARE in androgen induction of the
PSA
promoter. A construct with three ARR copies linked to a minimal
PSA
promoter showed a strong (104-fold) androgen induced activity. The ARR was also able to confer androgen responsiveness to a minimal
thymidine kinase
promoter. Both AR binding and transcriptional activity resided in a 20-base pair ARR subfragment: CAGGGATCAGGGAGTCTCAC (2S). Mutational analysis indicated that the sequence GGATCAgggAGTCTC in the 2S fragment is a functionally active, low affinity AR binding site. Like AR, the glucocorticoid receptor was able to stimulate
PSA
promoter activity. Both the ARE and ARR are involved in dexamethasone regulation of the
PSA
promoter. Both the AR and glucocorticoid receptor were 20-100-fold more active on ARR-
PSA
and ARR-
thymidine kinase
promoter constructs in LNCaP cells than in other cell types (COS, HeLa, Hep3B, and T47D cells), indicating (prostate) cell specificity.
...
PMID:Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter. 862 36
The role of
prostate-specific antigen
in the management of prostatic adenocarcinoma is still not fully ascertained. Its place in the monitoring of patients who have undergone radical treatment is without question but its role in the primary assessment of a lesion is a point of continuous discussion. This study reports the analysis of
prostate-specific antigen
(
PSA
) in 92 patients with different stages of prostatic adenocarcinoma prior to treatment; in the case of the localized lesions, this was based to a great extent on the findings at lymphadenectomy. Apart from
PSA
analysis,
deoxythymidine kinase
(dTK) analyses were also performed in an attempt to discover whether the latter could provide additional information about the tumor load in the different patient categories, viz. those with lymph node involvement (group 1), those with lymph node involvement but without distant metastases (group 2), and those with disseminated disease (group 3). The median
PSA
and dTK values in groups 1-3 were 6.5 micrograms/L and 2.7 U/microliter, 16 micrograms/L and 2.6 U/microL, and 90 micrograms/L and 7.8 U/microL, respectively. If the two analyses were used concomitantly, they could differentiate true localized disease from metastatic in approximately 92% of cases. The combination should prove of value in the primary assessment of a patient with a newly diagnosed prostatic adenocarcinoma.
...
PMID:Deoxythymidine kinase in the staging of prostatic adenocarcinoma. 868 50
Our laboratory has developed two cellular models of human prostate cancer progression. The LNCaP prostate cancer progression model is based upon the well-known cellular interaction between human prostate or bone stromal cells and LNCaP cells in vivo. The marginally tumorigenic LNCaP cells acquired tumorigenic and metastatic potential upon cellular interaction with either prostate or bone fibroblasts. A subline termed C4-2 was observed to grow readily in castrated animals and acquired metastatic potential spreading from the primary tumor site to the lymph node, the seminal vesicles, and the axial skeleton, resulting in an intense osteoblastic reaction. The second model is ARCaP, where prostate cancer cells derived from the ascites fluid of a man with metastatic disease exhibited an Androgen- and estrogen-Repressed Prostate Cancer cell growth and tumor formation in either a hormone-deficient or a castrated environment. However, the growth of either the tumor cells in vitro or the tumors in vivo was suppressed by both estrogen and androgen. While the tumor cells expressed low levels of androgen receptor and
prostate-specific antigen
(
PSA
), they were highly metastatic when inoculated orthotopically. Distant metastases to a number of organs were detected, including the liver, lung, kidney, and bone. We have employed a human prostate cancer progression model as a system to study the efficacy of gene therapy. Results of the study show that whereas universal promoters, such as Cytomegalovirus (CMV) and Rous Sarcoma Virus (RSV) promoter-driven tumor suppressors (e.g. p53, p21, and p16), were effective in inhibiting prostate tumor growth, the advantages of driving the expression of therapeutic toxic genes using a tissue-specific promoter
prostate-specific antigen
(
PSA
) and a tumor--but not tissue-specific promoter, osteocalcin (OC), are preferred. In the case of the
PSA
promoter, we can achieve cell-kill in
PSA
-producing human prostate cancer cells. To circumvent the supporting role of bone stroma for prostate cancer epithelial growth, we have recently developed a novel concept where the expression of therapeutic toxic genes is driven by a tumor--but not a tissue-specific OC promoter. Osteocalcin-
thymidine kinase
(OC-TK) was found to efficiently eradicate the growth of osteosarcoma, prostate, and brain tumors both in vitro and in vivo. We observed that androgen-independent human prostate cancer cells lines expressed OC-TK at higher levels than androgen-dependent human prostate cancer cell lines. We have obtained data to suggest that Ad-OC-TK plus a pro-drug acyclovir (ACV) may be used as an effective therapy to treat prostate cancer bone metastasis in models where the growth of androgen-independent PC-3 and C4-2 tumors in the bone has occurred.
...
PMID:Human prostate cancer progression models and therapeutic intervention. 943 28
Enzyme-prodrug therapy for the treatment of cancer is an experimental procedure that is under intensive investigation. However, the relative merits of the various systems for use under specific conditions are still being determined. We have compared the efficacy of cell killing by the herpesvirus
thymidine kinase
(HSVTK)/ganciclovir and the purine nucleoside phosphorylase (PNP)/9-(beta-M-2-deoxy-erythropentofuranosyl)6-methylpurine enzyme/prodrug systems. These were chosen because of their differential dependence on DNA replication for their mechanism of action. The HSVTK and PNP genes, expressed from the identical
prostate-specific antigen
promoter, were transduced into human prostate and breast cancers cells using the same human adenovirus vector. The kinetics of cell killing in the presence of the respective prodrugs was monitored using a nondestructive assay that measured total cell bioactivity. The PNP/9-(beta-D-2-deoxy-erythropentofuranosyl)6-methylpurine system was clearly superior in its ability to cause cell death in vitro. Cells were killed in about half the time and at a 5-10-fold lower input of virus relative to the HSVTK/ganciclovir system. The PNP system may offer advantages for the treatment of slow-growing tumors in which the daily proliferative rate is low or in situations in which gene delivery or expression is inefficient.
...
PMID:Relative efficiency of tumor cell killing in vitro by two enzyme-prodrug systems delivered by identical adenovirus vectors. 981 99
For patients with local recurrence of prostate cancer after definitive irradiation therapy there is no treatment widely considered safe and effective. After extensive preclinical testing of prodrug gene therapy in vitro and in vivo, we conducted a phase I dose escalation clinical trial of intraprostatic injection of a replication-deficient adenovirus (ADV) containing the herpes simplex virus
thymidine kinase
gene (HSV-tk) injected directly into the prostate, followed by intravenous administration of the prodrug ganciclovir (GCV). Our goal was to determine safe dose levels of the vector for future trials of efficacy. Patients with a rising serum
prostate-specific antigen
(
PSA
) level and biopsy confirmation of local recurrence of prostate cancer without evidence of metastases one or more years after definitive irradiation therapy were eligible for the trial. After giving informed consent, patients received injections of increasing concentrations of ADV/HSA-tk in 1 ml into the prostate under ultrasound guidance. Ganciclovir was then given intravenously for 14 days (5 mg/kg every 12 hr). Patients were monitored closely for evidence of toxicity and for response to therapy. Eighteen patients were treated at 4 escalating doses: group 1 (n = 4) received 1 x 10(8) infectious units (IU); group 2 (n = 5) received 1 x 10(9) IU; group 3 (n = 4) received 1 x 10(10) IU; group 4 (n = 5) received 1 x 10(11) IU. Vector was detected by PCR of urine samples after treatment, increasing in frequency and duration (up to 32 days) as the dose increased. All cultures of blood and urine specimens were negative for growth of adenovirus. Minimal toxicity (grade 1-2) was encountered in four patients. One patient at the highest dose level developed spontaneously reversible grade 4 thrombocytopenia and grade 3 hepatotoxicity. Three patients achieved an objective response, one each at the three highest dose levels, documented by a fall in serum
PSA
levels by 50% or more, sustained for 6 weeks to 1 year. This study is the first to demonstrate the safety of ADV/HSV-tk plus GCV gene therapy in human prostate cancer and the first to demonstrate anticancer activity of gene therapy in patients with prostate cancer. Further trials are underway to identify the optimal distribution of vector within the prostate and to explore the safety of repeat courses of gene therapy.
...
PMID:In situ gene therapy for adenocarcinoma of the prostate: a phase I clinical trial. 1034 May 55
The efficacy of combination suicide gene therapy was evaluated using a Herpes simplex virus-
thymidine kinase
/ganciclovir (HSV-TK/GCV) system and an Escherichia coli cytosine deaminase/5-fluorocytosine (CD/5-FC) system on the LNCaP human prostate cancer cell model. Two types of plasmid vectors with the HSV-TK gene were constructed. A constitutive chicken beta-actin promoter drove one and a
prostate-specific antigen
(
PSA
) promoter drove the other. Similarly, a pair of plasmids with the CD gene under a cytomegalovirus (CMV) promoter and the
PSA
promoter was also constructed. LNCaP cells were transfected in vitro with either or both of those plasmids using a cationic lipid reagent. Transfected cells were treated with GCV and/or 5-FC. The percentage of viable LNCaP cells 7 days after treatment with HSV-TK/GCV or CD/5-FC under a constitutive promoter was 40% and 41% of controls, respectively. The cell viability when two suicide genes were combined was 23%. The cell viabilities after four days with
PSA
promoter-HSV-TK vectors, CD vectors and a combination of both were 79%, 88% and 88%, respectively. Suicide gene therapy using either HSV-TK/GCV, CD/5-FC, or both, was effective in the LNCaP model. An additive effect was observed when the two suicide genes were used together. The
PSA
promoter did not seem to be effective enough to elicit cytotoxicity under the experimental conditions used here.
...
PMID:Suicide gene therapy on LNCaP human prostate cancer cells. 1144 69
To more accurately determine the tissue-specific expression of the target gene in prostate cancer cells, we introduced the enhancer element (-4,777 to -3,934; PSAR) and the promoter region (PSAP) of the
prostate-specific antigen
(
PSA
) gene. Furthermore, to elucidate the advantages of using liposomes as a gene carrier, we screened more than 20 liposome preparations in this study. The 5' upstream region of
PSA
gene (PSARPSAP) was conjugated to either the chloramphenicol acetyltransferase (CAT) gene or herpes simplex virus
thymidine kinase
(TK) gene, and the transfection of these plasmids was carried out using cationic liposomes, DMRIE-C (Gibco) or LipoTAXI (Stratagene). The expression of CAT activity was clearly observed when PSARPSAP-CAT plasmid was transfected into
PSA
-positive LNCaP cells, whereas no CAT activity was detected in
PSA
-negative DU145 cells or bladder carcinoma T24 cells. The CAT activity increased after the addition of testosterone. We then evaluated the therapeutic effect of the PSARPSAP-TK plasmid in vitro. When PSARPSAP-TK plasmid was transfected and ganciclovir was added to the medium, the growth of LNCaP cells was inhibited, while no growth inhibition was observed in DU145 cells. Furthermore, this inhibitory effect was observable even when the cells were cultured in a medium supplemented with dialyzed fetal bovine serum. These results suggest that the liposome-mediated transfection of PSARPSAP-TK appears to be a potentially effective approach for selecting the optimal treatment for tumor cells producing
PSA
even with the low androgen levels seen in patients treated by anti-androgen therapy.
...
PMID:Liposome-mediated gene therapy using HSV-TK/ganciclovir under the control of human PSA promoter in prostate cancer cells. 1159 49
We are developing assays to image tissue-specific reporter gene expression in living mice by using optical methods and positron emission tomography. Approaches for imaging reporter gene expression depend on robust levels of mRNA and reporter protein. Attempts to image reporter gene expression driven by weak promoters are often hampered by the poor transcriptional activity of such promoters. Most tissue-specific promoters are weak relative to stronger but constitutively expressing viral promoters. In this study, we have validated methods to enhance the transcriptional activity of the
prostate-specific antigen
promoter for imaging by using a two-step transcriptional amplification (TSTA) system. We used the TSTA system to amplify expression of firefly luciferase (fl) and mutant herpes simplex virus type 1
thymidine kinase
(HSV1-sr39tk) in a prostate cancer cell line (LNCaP). We demonstrate approximately 50-fold (fl) and approximately 12-fold (HSV1-sr39tk) enhancement by using the two-step approach. The TSTA system is observed to retain tissue selectivity. A cooled charge-coupled device optical imaging system was used to visualize the amplified fl expression in living mice implanted with LNCaP cells transfected ex vivo. These imaging experiments reveal a approximately 5-fold gain in imaging signal by using the TSTA system over the one-step system. The TSTA approach will be a valuable and generalizable tool to amplify and noninvasively image reporter gene expression in living animals by using tissue-specific promoters. The approaches validated should have important implications for study of gene therapy vectors, cell trafficking, transgenic models, as well as studying development of eukaryotic organisms.
...
PMID:Two-step transcriptional amplification as a method for imaging reporter gene expression using weak promoters. 1173 53
Adenovirus-mediated suicide gene therapy may hold promise in the treatment of human cancer. We have developed a novel approach that utilizes a lytic, replication-competent adenovirus (Ad5-CD/TKrep) to deliver a cytosine deaminase/herpes simplex virus-1
thymidine kinase
fusion gene to tumors. The cytosine deaminase and herpes simplex virus-1
thymidine kinase
suicide genes render malignant cells sensitive to specific pharmacological agents and, importantly, sensitize them to radiation. The Phase I study described here represents the first gene therapy trial in which a replication-competent virus was used to deliver a therapeutic gene to humans. The indication is local recurrence of prostate cancer after definitive radiation therapy. An escalating dose (10(10), 10(11), and 10(12) viral particles) of the Ad5-CD/TKrep virus was injected intraprostatically under transrectal ultrasound guidance into 16 patients in four cohorts. Two days later, patients were given 5-fluorocytosine and ganciclovir prodrug therapy for 1 (cohorts 1-3) or 2 (cohort 4) weeks. There were no dose-limiting toxicities, and the maximum tolerated dose of the Ad5-CD/TKrep vector was not defined. Ninety-four percent of the adverse events observed were mild or moderate (grade 1/2) in nature. Seven of 16 (44%) patients demonstrated a >or=25% decrease in serum
prostate-specific antigen
, and 3 of 16 (19%) patients demonstrated a >or=50% decrease in serum
prostate-specific antigen
. Transgene expression and tumor destruction at the injection site were confirmed by sextant needle biopsy of the prostate at 2 weeks. Two patients were negative for adenocarcinoma at 1 year follow-up. Although Ad5-CD/TKrep viral DNA could be detected in blood as far out as day 76, no infectious adenovirus was detected in patient serum or urine. Together, the results demonstrate that intraprostatic administration of the replication-competent Ad5-CD/TKrep virus followed by 2 weeks of 5-fluorocytosine and ganciclovir prodrug therapy can be safely applied to humans and is showing signs of biological activity.
...
PMID:Phase I study of replication-competent adenovirus-mediated double suicide gene therapy for the treatment of locally recurrent prostate cancer. 1220 48
1
2
Next >>