Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:2.7.1.21 (
thymidine kinase
)
7,561
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Of 102 patients suffering from prostatic carcinoma, complete data on the serum concentration of 7 tumour markers were available from 90 patients, together with tumour grade, local stage and the presence or absence of skeletal metastases. The serum content of prostatic acid phosphatase,
prostate specific antigen
, neopterin,
thymidine kinase
, osteocalcin, C-reactive protein and tissue polypeptide antigen was measured. By means of Cox's regression and multivariate analysis the ability of these variables to predict prognosis, i.e. death from prostatic cancer, was studied. Neopterin appeared to be the most efficient marker, followed by tumour grade,
thymidine kinase
and
prostate specific antigen
. No other variable provided information of statistical significance. In multivariate analysis
thymidine kinase
performed best, followed by neopterin, tumour grade and
prostate specific antigen
. Several serum tumour markers reflect the biological activity of human prostate cancers and their value should be further explored. They may become useful in the management of individual patients.
...
PMID:Tumour markers as prognostic aids in prostatic carcinoma. 169 4
Serum from 102 patients was analysed with regard to its content of prostatic acid phosphatase (PAP),
prostate specific antigen
(
PSA
), neopterin, osteocalcin,
thymidine kinase
, C-reactive protein, and of tissue polypeptide antigen (TPA). The levels were related to the short-term survival (death from cancer within 3 years) and compared by statistical means. A comparison was also made with tumour grade and stage and the presence or not of metastatic lesions. In this study neopterin was found to be most closely related to the clinical course followed by tumour grade,
thymidine kinase
and
PSA
. When all these four variables were in the equation no other parameter added any information of statistical significance. The importance of selecting appropriate cut off values ('normal' vs 'elevated') when using the serum marker as a prognostic indicator is also discussed.
...
PMID:Serum tumour markers in human prostatic carcinoma. The value of a marker panel for prognostic information. 202 1
This chapter mainly deals with biochemical aspects on
prostate specific antigen
(
PSA
) and its clinical value. To a limited extent, also other tumor markers, which might be of importance in the evaluation of patients with prostate cancer are discussed. In serum,
PSA
exists in a free form or bound to antichymotrypsin. Interestingly, only 10% of
PSA
secreted from cancer cells seems to exist in a free form, as compared to 30% of
PSA
secreted from cells in benign prostatic hyperplasia (BPH).
PSA
seems to be closely, but not absolutely, related to tumor grade and stage. The mean value of
PSA
in patients with tumors dominated by Gleason grades 3 or below, was 10 ng/ml, compared to 29 ng/ml in those with higher grades. Patients with
PSA
values of 50 ng/ml or above almost exclusively had tumor of Gleason grades 4 or 5, and this limit usually reflected a generalized disease. Patients with
PSA
-values below 10 ng/ml almost exclusively had tumors confined to the prostate gland. In countries where screening for prostate cancer is believed in, it is important to understand that normal cut-off values are related to patient's age. The upper normal limit of males below 50 years of age should be set at 2.5 ng/ml, as compared to 6.5 ng/ml for men over 70 years of age. To improve the value of
PSA
determination and for scientific purposes, the standardization of the assay is urgently needed and under way. Prostate acid phosphatase (PAP) has in most centres been replaced by
PSA
. An elevated PAP value, as measured by the enzymatic method, invariably indicates a generalized disease and could thus be used as a complementary informative assay to
PSA
. Other markers have been used mainly to achieve additional prognostic information. In a multivariate analysis, the non-specific tumor marker neopterin, which reflects the host response to tumor antigens, was closely related to short-term prognosis. Neopterin was followed by
thymidine kinase
, a protein reflecting the cell turn-over and tumor grade. Also
PSA
at diagnosis seemed to add some prognostic information, whereas other markers did not.
...
PMID:Tumor markers. Consensus Conference on Diagnosis and Prognostic Parameters in Localized Prostate Cancer. Stockholm, Sweden, May 12-13, 1993. 752 30
Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (
PSA
-ARR) identified in the promoter of the
prostate specific antigen
(
PSA
) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR,
PSA
-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a
thymidine kinase
promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.
...
PMID:Identification and characterization of two androgen response regions in the human neutral endopeptidase gene. 1116 97
The
prostate specific antigen
(
PSA
) promoter/enhancer has been clearly demonstrated to be tissue specific, and has been applied to prostate-specific gene therapy. However, the transcription of the
PSA
gene is strictly androgen dependent, and its promoter activity is very weak at low concentrations of testosterone, which are generally observed in prostatic cancer patients treated with androgen deprivation. In this study, we used a partial androgen receptor (ARf) containing amino acids 232-429 and 481-657 to transactivate the
PSA
gene without androgens. We made two expression vectors, ARfPPLUC and ARfPPTK. They contained ARf cDNA driven by cytomegalovirus promoter and cDNAs of either firefly luciferase (LUC) or herpes simplex virus
thymidine kinase
(TK) driven by
PSA
promoter/enhancer (PP). The expressed ARf enhanced the PP activity by about 110-fold in the
PSA
-producing prostate cancer cell line, LNCaP, under low testosterone concentrations. Moreover, in a
PSA
-nonproducing prostate cancer cell line, DU145, ARf also enhanced the PP activity by about 60-fold in an androgen-independent manner. In a growth inhibition assay, ARfPPTK treated with ganciclovir was found to inhibit the cell growth of LNCaP cells much more effectively than PPTK. Furthermore, in contrast to PPTK, ARfPPTK also had an inhibitory effect on DU145 cells. This system is thus considered to provide a useful therapeutic option in patients with prostate cancer who are receiving hormonal therapy.
...
PMID:Coexpression of the partial androgen receptor enhances the efficacy of prostate-specific antigen promoter-driven suicide gene therapy for prostate cancer cells at low testosterone concentrations. 1124 19
To enhance the efficacy of suicide gene therapy for prostate cancer under androgen deprivation, we designed a promoter system that consists of the prostate-specific membrane antigen (PSMA) promoter / enhancer (PEPM) and Cre-loxP DNA recombination system. We constructed two kinds of plasmids. One plasmid contains a Cre recombinase (Cre) under the control of PEPM and the other expresses CMV-lox-luciferase / herpes simplex virus
thymidine kinase
(TK). In PSMA-positive LNCaP cells, the promoter activity of the PEPM-Cre plus CMV-lox-luciferase demonstrated 800-fold greater activity compared with that of the PSMA promoter alone. However, no enhancement of the promoter activity was observed in the PSMA-negative cells. Furthermore, in contrast to
prostate specific antigen
promoter / enhancer (PP), the promoter activity of PEPM did not decrease when the LNCaP cells were cultured in charcoal-stripped fetal bovine serum (CFBS). In an in vitro gene therapy model with LNCaP cells, the cell growth inhibition in the presence of ganciclovir (GCV) was more evident in the cells transfected with the PEPM-Cre plus CMV-lox-TK than in the cells with the PP-TK, and the difference in efficacy between the two plasmids was more remarkable when the cells were maintained in CFBS medium. The therapeutic effect of PEPM-Cre plus CMV-lox-TK was also observed in xenografted LNCaP cells on nude mice when the plasmids were directly injected into tumors and GCV was administered intraperitoneally. These findings indicate that the combination of the PSMA promoter / enhancer and the Cre-loxP system can enhance the PSMA promoter activity even under androgen ablation conditions and can exert its anti-tumor effect both in vitro and in vivo.
...
PMID:Development of gene therapy using prostate-specific membrane antigen promoter/enhancer with Cre Recombinase/LoxP system for prostate cancer cells under androgen ablation condition. 1241 46