Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:2.4.2.30 (
PARP
)
13,611
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Myocardial ischemia and reperfusion lead to myocyte cell death, at least in part, by an apoptotic mechanism. Caspases are a conserved family of proteases that play an essential role in the execution of apoptosis; however, their potential contribution to ischemic myocardial cell death is largely unknown. To examine their role in this process, we subjected rabbits to 30 min of coronary artery occlusion followed by 3 h of reperfusion. Immunoblot analyses revealed that caspases-2, -3 and -7 were proteolytically activated during myocardial ischemia and reperfusion in vivo. In addition, the well-characterized caspase substrate poly(ADP-ribose) polymerase (
PARP
) was selectively cleaved into its signature apoptotic fragment in ischemic/reperfused myocardium. Systemic administration of the broad-spectrum caspase inhibitor acetyl-Tyr-Val-Ala-Asp chloromethylketone (YVAD-cmk, 4.8 mg/kg) partially blocked caspase activation and dramatically reduced the percentage of terminal dUTP deoyxynucleotidyl-transferase nick end-labeling (TUNEL)-positive myocyte nuclei in the infarct region (3.9+/-0.8%v 13.0+/-2.2% in control animals, P=0.012). Moreover, YVAD-cmk reduced myocardial infarct size by approximately 31% (31.1+/-3.3%v 45.3+/-4.9% in control animals, P=0.032). These results indicate that caspases are critical mediators of myocardial injury induced by ischemia and reperfusion in vivo, and they suggest that caspase inhibition may be therapeutically beneficial in myocardial infarction.
J
Mol
Cell Cardiol 1999 Sep
PMID:Caspase inhibition reduces myocyte cell death induced by myocardial ischemia and reperfusion in vivo. 1047 54
Apoptosis has been hypothesized to be mediated through the induction of free radicals via oxidative pathway. In this study, we demonstrated the induction of cellular apoptosis by anoxia-hyperoxia shift, but not by anoxia or hyperoxia alone in NIH3T3 cells. The decrement of ROS by anoxia thus appears to be an essential early event leading to apoptosis. G1 arrest was detected in anoxia-treated cells, and postanoxic oxygen recovery could reverse this effect, and induce apoptosis. On analysis of the binding activity of AP-1, we found biphasic induction of binding ability in cells undergoing anoxia-hyperoxia shift. In the early stage of anoxia, a transitional increase of AP-1 binding activity was detected, which was reduced to the minimal levels after 24 h of anoxia. During the period of postanoxic hyperoxia treatment, the binding activity of AP-1 was reinduced and increased remarkably with time up to 24 h. These results were in accordance with the expressions of c-jun and c-fos proteins. Enhancement of poly(ADP-ribosyl)ation activities, especially ADP-ribosylation of histone H1 was detected in post-anoxic hyperoxia-treated cells, and cleavage of
PARP
and activation of caspase 3 were also observed in post-anoxic hyperoxia (recovery) treated cells, but not in anoxia-treated cells. We propose that the differential induction of c-jun/c-fos (AP-1) gene expressions and sequential activation of
PARP
activity are essential in anoxia/hyperoxia-induced apoptosis.
Mol
Cell Biochem 1999 Jul
PMID:Elevation of apoptotic potential by anoxia hyperoxia shift in NIH3T3 cells. 1048 34
Some widely used antidepressants such as imipramine, clomipramine, and citalopram have been found to possess antineoplastic effects. In the present study, these compounds were found to induce apoptotic cell death in human acute myeloid leukemia HL-60 cells. Apoptosis induced by the antidepressants was identified by electron microscopy and conventional agarose gel electrophoresis and was quantitated by propodium iodide staining and the terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) via flow cytometry. Treatment with apoptosis-inducing concentrations of the antidepressants (80 microM imipramine, 35 microM clomipramine, or 220 microM citalopram) caused induction of caspase-3/caspase-3-like activity, which was monitored by the cleavage of poly(ADP-ribose) polymerase (
PARP
), the loss of the 32 kD caspase-3 (CPP32) precursor, and the cleavage of the fluorescent CPP32-like substrate PhiPhiLux. Pretreatment with a potent caspase inhibitor benzyloxycarbonyl-Val-Ala-Asp-fluoromethyl-ketone (zVAD-fmk) inhibited antidepressant-induced CPP32/CPP32-like activity and apoptosis. Furthermore, activation of caspase induced by the antidepressants was preceded by the hypergeneration of intracellular reactive oxygen species (ROS). These results suggested that the antidepressants may induce apoptosis via a caspase-3-dependent pathway, and induction of apoptosis by the antidepressants may provide a clue for the mechanism of their antineoplastic effects.
J Biochem
Mol
Toxicol 1999
PMID:The antidepressants imipramine, clomipramine, and citalopram induce apoptosis in human acute myeloid leukemia HL-60 cells via caspase-3 activation. 1048 22
Peroxynitrite is a cytotoxic oxidant produced during shock, ischemia reperfusion, and inflammation. The cellular events mediating the cytotoxic effect of peroxynitrite include activation of poly(ADP-ribose) synthetase, inhibition of mitochondrial respiration, and activation of caspase-3. The aim of the present study was to investigate the role of intracellular calcium mobilization in the necrotic and apoptotic cell death induced by peroxynitrite. Peroxynitrite, in a low, pathophysiologically relevant concentration (20 microM), induces rapid (1 to 3 min) Ca(2+) mobilization in thymocytes. Inhibition of this early calcium signaling by cell-permeable Ca(2+) chelators [EGTA-acetoxymethyl ester (AM), 1, 2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid-AM (BAPTA-AM), 8-amino-2-[(2-amino-5-methylphenoxy)methyl]-6-methoxyquinoline-N,N , N',N'-tetraacetic acid-tetra-AM] abolished cytotoxicity as measured by propidium iodide uptake. Intracellular Ca(2+) chelators also inhibited DNA single-strand breakage and activation of
poly(ADP-ribose) synthase
(PARS), which is a major mediator of cell necrosis in the current model. Intracellular Ca(2+) chelators also protected PARS-deficient thymocytes from peroxynitrite cytotoxicity, providing evidence for a PARS-independent, Ca(2+)-dependent cytotoxic pathway. Chelation of intracellular Ca(2+) blocked the peroxynitrite-induced decrease of mitochondrial membrane potential, secondary superoxide production, and mitochondrial membrane damage. Peroxynitrite-induced internucleosomal DNA cleavage was increased on BAPTA-AM pretreatment in the wild-type cells but decreased in the PARS-deficient cells. Two other apoptotic parameters (phosphatidylserine exposure and caspase 3 activation) were inhibited by BAPTA-AM in both the wild-type and the PARS-deficient thymocytes. Our findings provide evidence for the pivotal role of an early Ca(2+) signaling in peroxynitrite cytotoxicity.
Mol
Pharmacol 1999 Oct
PMID:Requirement of intracellular calcium mobilization for peroxynitrite-induced poly(ADP-ribose) synthetase activation and cytotoxicity. 1049 67
Since caspase members have been identified as effectors of apoptosis, the role of CPP32/caspase-3 was further explored in cultured neurons from the embryonic rat forebrain submitted to a 6-h hypoxia which has previously been shown to induce apoptotic death within four days after reoxygenation, whereas a shorter aggression (i.e., for 3 h) leads by the same time to an increased number of living neurons, suggesting that sublethal hypoxia may promote neurogenesis. Neuronal expression of the active cleavage product of CPP32 (CPP32 p20) increased specifically after hypoxia for 6 h to finally reach 985% over control normoxic values at 96 h post-insult, while a 3-h hypoxia triggered the inducible stress protein HSP70 that has been shown to inhibit caspase-3. Proteolytic activity of caspase-3 was progressively stimulated by lethal hypoxia, as reflected by the degradation of two selective substrates, including poly (ADP-ribose) polymerase (
PARP
). Caspase-3 activity was blocked specifically and dose-dependently by the peptide inhibitor, DEVD-CHO, that reduced the number of apoptotic cells and prevented the hypoxia-induced decrease in cell viability, including when given 24 h post-insult. Interestingly, in these conditions, the inhibitory compounds enhanced the number of mitotic neurons. These data emphasize the critical role of caspase-3 in neuronal injury consecutive to hypoxia. Whereas caspase inhibitors may provide benefit over a broad therapeutic window, they might allow developing neurons to complete their cell cycle initiated in response to stress, as it is the case for sublethal hypoxia.
Brain Res
Mol
Brain Res 1999 Aug 25
PMID:CPP32/CASPASE-3-like proteases in hypoxia-induced apoptosis in developing brain neurons. 1052 77
An expression vector was constructed to express foreign genes in Trypanosoma congolense. The foreign gene and a neomycin phosphotransferase (NPT) gene are flanked by glutamate and alanine rich protein (GARP) gene processing signals and their expression is driven by a ribosomal RNA gene promoter. The plasmid is not maintained as an episome in T. congolense, but the NPT gene permits selection of cells in which the plasmid has integrated into the genome. We used this plasmid to express luciferase, green fluorescent protein and a surface protein of Trypanosoma brucei, glycine-proline-glutamate glutamate threonine procyclic acidic repetitive protein (GPEET
PARP
). The plasmid-derived GPEET
PARP
is expressed on the surface of procyclic T. congolense and comigrates on a polyacrylamide gel with native GPEET
PARP
from T. brucei procyclic cells. We also attempted to use the plasmid to overexpress a previously identified T. congolense cysteine protease. The plasmid-derived cysteine protease mRNA species occurs in the transfected cells, but we were unable to detect increased levels of protein or protease activity.
Mol
Biochem Parasitol 1999 Oct 25
PMID:Expression of foreign proteins in Trypanosoma congolense. 1058 80
A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (
PARP
). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable
PARP
purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-
PARP
antibody revealed centromeric localization of
PARP
, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged
PARP
-binding region around the core centromere-active domain, suggesting possible 'spreading' of
PARP
into surrounding non-core centromeric domains. Enhanced
PARP
signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome.
PARP
signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of
PARP
binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of
PARP
during S/G(2)phase and that the total proportion of
PARP
that is centromeric is relatively low. Strong binding of
PARP
to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.
Hum
Mol
Genet 2000 Jan 22
PMID:Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase. 1060 29
Oxygen deprivation for prolonged periods leads to cardiac cell death and ventricular dysfunction. The ability to prevent myocardial cell death would be of significant therapeutic value in maintaining cardiac function after injury. While caspases have been suggested to play a critical role in apoptosis, their involvement during hypoxic injury has not been formally determined. In this report, we show that adult ventricular myocytes subjected to hypoxia for 1 h undergo a three-fold increase (P<0.05) in the incidence of apoptosis as determined by TUNEL analysis and Hoechst 33258 nuclear staining. Western blot analysis of hypoxic myocytes revealed a 10-fold increase in the proteolytic processing of caspase 3 to p17 with a concomitant cleavage of the caspase 3 substrate
PARP
from 116 kd to p85 kd compared to normoxic controls. Defects in mitochondrial membrane integrity were also observed as evidenced by the translocation of cytochrome c from the mitochondrial to cytosolic compartment of hypoxic cells. Pretreatment of ventricular myocytes with the peptide-caspase inhibitor known to block caspases related to caspase 1 (Ac-YVAD-CHO) attenuated cytochrome c release, processing of caspase 3, and apoptosis. While the caspase inhibitor (Ac-DEVD-CHO) which blocks caspases related to caspase 3, suppressed the cleavage of
PARP
and apoptosis, it had no effect on cytochrome c release by mitochondria. The data provide direct evidence for the proteolytic activation of caspases during hypoxia-mediated apoptosis of adult ventricular myocytes. Furthermore, the data suggest a hierarchical scheme for caspase activation with mitochondrial cytochrome c release occurring proximally to DEVD-CHO-inhibitable caspases.
J
Mol
Cell Cardiol 2000 Jan
PMID:Caspase activation and mitochondrial cytochrome C release during hypoxia-mediated apoptosis of adult ventricular myocytes. 1065 90
Ischemia/reperfusion leading to myocyte cell death has been reported as either necrotic or apoptotic or a combination of both. The importance of necrosis is well established but the role of apoptosis and the time of initiation are still unknown. Normothermic global ischemia of either 45 or 90 min duration followed by 6 h of reperfusion were induced in isolated canine hearts. After 45 min of ischemia, left ventricular function and adenine nucleotide (AN) content had recovered during reperfusion indicating reversible injury. DNA fragmentation determined by terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) was absent as was the 85 kDa fragment of poly-(ADP-ribose) polymerase (
PARP
). After 90 min of ischemia, electron microscopy indicated necrotic cell death in 90% of myocytes. Recovery of function and AN content during reperfusion was minimal. At the end of ischemia, caspase-3 was activated in 30% of all myocytes and
PARP
85 kDa fragments were present by Western blot, indicating initiation of the apoptotic cascade. Lamin-B(1)labeling was significantly reduced from 90% in myocytes in control and ischemia to 30% in early reperfusion. Completion of apoptosis seen by TUNEL was evident in late reperfusion (7.6% of myocytes and 8.3% of non-myocytes). Experiments with 6 h ischemia without reperfusion showed absence of DNA fragmentation. We conclude that apoptotic cell death is initiated by ischemia but that reperfusion is needed for completion of the apoptotic cascade. Furthermore, it is concluded that cell death in acute global ischemia followed by reperfusion occurs predominantly by necrosis and that apoptosis is of minor importance in this pathophysiological situation.
J
Mol
Cell Cardiol 2000 Feb
PMID:Apoptosis is initiated by myocardial ischemia and executed during reperfusion. 1072 97
Fas-induced apoptosis is one form of programmed cell death responsible for hepatocyte demise. However, the role of this cell surface receptor in the death of tumoral hepatic cells is still being debated. It has been shown that some hepatoma cell lines may escape apoptosis because of abnormal Fas localization correlated with non-functionality of the Fas protein or dysfunctionality in the Fas pathway cascade. The aim of this study was to investigate the behaviour of four hepatoma cell lines, HepG2, Hep3B, SKHep1 and Chang-Liver and two extrahepatic cell lines, MCF7, a mammary tumoral cell line and OVCAR-3, an ovarian tumoral cell line, when they were treated with an agonistic anti-Fas antibody alone, with interferon gamma (IFNgamma), an up-regulator of Fas protein expression, alone or with a combination of both agents. We first performed immunofluorescence and flow cytometry to confirm that Fas was present on the cell surface of each cell line in the normal state. Apoptosis was then investigated after induction with the various treatments, by DAPI staining, agarose gel DNA electrophoresis and
PARP
cleavage. Caspase 8 and 3 expression, as well as two anti-apoptotic proteins Bcl-2 and HSP70, and one proapoptotic protein Bax were also investigated by immunoblot allowing identification of several apoptotic pathways based on the behaviour of the different studied proteins. HepG2 and OVCAR-3 cells were sensitive to the anti-Fas antibody alone. Hep3B was resistant to Fas-induced apoptosis but sensitive to IFNgamma-induced apoptosis. MCF7 was resistant to anti-Fas antibody and IFNgamma Chang-Liver and SKHep1 were sensitive to IFNgamma and anti-Fas antibody but at different degrees. Chang-Liver used the Fas and IFNgamma pathways, while SKHep1 involved mostly the Fas pathway. These results show that each tumor cell line is characterized by different apoptotic behaviour in relation to Fas and/or IFNgamma-induced apoptosis. In addition, despite the high level of Bcl-2 and HSP70 proteins in the tumoral cells investigated here, they were not fully protected against apoptosis, except for MCF7. This emphasizes the necessity to analyse the different proteins responsible for apoptosis to adapt anti-tumoral therapeutics.
Cell
Mol
Biol (Noisy-le-grand) 2000 Feb
PMID:Apoptotic behaviour of hepatic and extra-hepatic tumor cell lines differs after Fas stimulation. 1072 68
<< Previous
1
2
3
4
5
6
7
8
9
10