Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:2.4.2.30 (PARP)
13,611 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Tankyrase, a protein with homology to ankyrins and to the catalytic domain of poly(adenosine diphosphate-ribose) polymerase (PARP), was identified and localized to human telomeres. Tankyrase binds to the telomeric protein TRF1 (telomeric repeat binding factor-1), a negative regulator of telomere length maintenance. Like ankyrins, tankyrase contains 24 ankyrin repeats in a domain responsible for its interaction with TRF1. Recombinant tankyrase was found to have PARP activity in vitro, with both TRF1 and tankyrase functioning as acceptors for adenosine diphosphate (ADP)-ribosylation. ADP-ribosylation of TRF1 diminished its ability to bind to telomeric DNA in vitro, suggesting that telomere function in human cells is regulated by poly(ADP-ribosyl)ation.
...
PMID:Tankyrase, a poly(ADP-ribose) polymerase at human telomeres. 986 37

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible 'spreading' of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.
...
PMID:Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase. 1060 29

The average length of telomere repeats at the ends of chromosomes in most normal human somatic cells has been found to decrease by 50-200 base pairs with each cell division. The loss of telomere repeats has been causally linked to replicative senescence by the demonstration that overexpression of the enzyme telomerase can result in the elongation or maintenance of telomeres and immortalization of somatic cells with a diploid and apparently normal karyotype. Major questions that remain are related to the actual mechanism by which telomere shortening induces replicative senescence and the importance of telomere shortening and replicative senescence in the homeostasis of cells in renewal tissues and aging. This perspective is concerned with the consequences of telomere shortening at individual chromosomes in individual cells. Experimental evidence indicates that short telomeres accumulate prior to senescence and that replicative senescence is not triggered by the first telomere to reach a critical minimal threshold length. These observations are compatible with limited repair of short telomeres by telomerase-dependent or telomerase-independent DNA repair pathways. Deficiencies in telomere repair may result in accelerated senescence and aging as well as genetic instability that facilitates malignant transformation. Examples of molecules that may have a role in the repair of telomeric DNA prior to replicative senescence include ATM, p53, PARP, DNA-PK, Ku70/80, the human hRad50-hMre11-p95 complex, BRCA 1 and 2 and the helicases implicated in Bloom's and Werner's syndrome.
...
PMID:Repair of telomeric DNA prior to replicative senescence. 1098 22

Human telomeres are maintained by telomerase, a reverse transcriptase that adds telomeric repeats to chromosome ends [1,2]. In human tumors and immortalized cells, telomeres are often maintained at a constant length setting [3,4], indicating that telomerase-mediated telomere elongation is tightly regulated. Tankyrase, a telomeric poly(ADP-ribose) polymerase (PARP) [5], was identified through its interaction with TRF1 [6], a negative regulator of telomere extension by telomerase [7]. Tankyrase-mediated ADP-ribosylation inhibits binding of TRF1 to telomeric repeats in vitro [5], suggesting that tankyrase might regulate TRF1 and therefore control telomere dynamics in vivo. Here, we present evidence that tankyrase acts as a positive regulator of telomere elongation in vivo, apparently by inhibiting TRF1. Overexpression of tankyrase in the nucleus diminished the level of unmodified TRF1 in immunoblots and led to reduced immunofluorescence of TRF1 at interphase telomeres. Long-term overexpression of tankyrase in telomerase-positive human cells resulted in a gradual and progressive elongation of telomeres. A PARP-deficient form of tankyrase failed to affect TRF1 and did not alter telomere length dynamics, consistent with ADP-ribosylation of TRF1 as the main cause of altered telomere homeostasis. Our results indicate that tankyrase can induce telomere elongation in human cells. We propose that tankyrase-mediated ADP-ribosylation of TRF1 opens the telomeric complex, allowing access to telomerase.
...
PMID:Tankyrase promotes telomere elongation in human cells. 1106 13

Poly(ADP-ribosyl)ation is a post-translational modification occurring in the nucleus. The most abundant and best-characterized enzyme catalyzing this reaction, poly(ADP-ribose) polymerase 1 (PARP1), participates in fundamental nuclear events. The enzyme functions as molecular "nick sensor". It binds with high affinity to DNA single-strand breaks resulting in the initiation of its catalytic activity. Activated PARP1 promotes base excision repair. In addition, PARP1 modifies several transcription factors and thereby precludes their binding to DNA. We propose that a major function of PARP1 includes the silencing of transcription preventing expression of damaged genes. Concomitant stimulation of DNA repair suggests that PARP1 acts as a switch between transcription and DNA repair. Another PARP-type enzyme, tankyrase, is involved in the regulation of telomere elongation. Tankyrase modifies a telomere-associated protein and thereby prevents it masking telomeric repeats providing access of telomerase for telomere elongation. Therefore, poly(ADP-ribosyl)ation reactions may act as molecular switches in DNA metabolism.
...
PMID:A cellular survival switch: poly(ADP-ribosyl)ation stimulates DNA repair and silences transcription. 1138 34

Poly(ADP-ribose) polymerase (PARP)-1, a detector of single-strand breaks, plays a key role in the cellular response to DNA damage. PARP-1-deficient mice are hypersensitive to genotoxic agents and display genomic instability due to a DNA repair defect in the base excision repair pathway. A previous report suggested that PARP-1-deficient mice also had a severe telomeric dysfunction consisting of telomere shortening and increased end-to-end fusions (d'Adda di Fagagna, F., M.P. Hande, W.-M. Tong, P.M. Lansdorp, Z.-Q. Wang, and S.P. Jackson. 1999. NAT: Genet. 23:76-80). In contrast to that, and using a panoply of techniques, including quantitative telomeric (Q)-FISH, we did not find significant differences in telomere length between wild-type and PARP-1(-/)- littermate mice or PARP-1(-/)- primary cells. Similarly, there were no differences in the length of the G-strand overhang. Q-FISH and spectral karyotyping analyses of primary PARP-1(-/)- cells showed a frequency of 2 end-to-end fusions per 100 metaphases, much lower than that described previously (d'Adda di Fagagna et al., 1999). This low frequency of end-to-end fusions in PARP-1(-/)- primary cells is accordant with the absence of severe proliferative defects in PARP-1(-/)- mice. The results presented here indicate that PARP-1 does not play a major role in regulating telomere length or in telomeric end capping, and the chromosomal instability of PARP-1(-/)- primary cells can be explained by the repair defect associated to PARP-1 deficiency. Finally, no interaction between PARP-1 and the telomerase reverse transcriptase subunit, Tert, was found using the two-hybrid assay.
...
PMID:Normal telomere length and chromosomal end capping in poly(ADP-ribose) polymerase-deficient mice and primary cells despite increased chromosomal instability. 1144 89

Telomere maintenance is essential for the continuous growth of tumor cells. In most human tumors telomeres are maintained by telomerase, a specialized reverse transcriptase. Tankyrase 1, a human telomeric poly(ADP-ribose) polymerase (PARP), positively regulates telomere length through its interaction with TRF1, a telomeric DNA-binding protein. Tankyrase 1 ADP-ribosylates TRF1, inhibiting its binding to telomeric DNA. Overexpression of tankyrase 1 in the nucleus promotes telomere elongation, suggesting that tankyrase 1 regulates access of telomerase to the telomeric complex. The recent identification of a closely related homolog of tankyrase 1, tankyrase 2, opens the possibility for a second PARP at telomeres. We therefore sought to establish the role of tankyrase 1 at telomeres and to determine if tankyrase 2 might have a telomeric function. We show that endogenous tankyrase 1 is a component of the human telomeric complex. We demonstrate that telomere elongation by tankyrase 1 requires the catalytic activity of the PARP domain and does not occur in telomerase-negative primary human cells. To investigate a potential role for tankyrase 2 at telomeres, recombinant tankyrase 2 was subjected to an in vitro PARP assay. Tankyrase 2 poly(ADP-ribosyl)ated itself and TRF1. Overexpression of tankyrase 2 in the nucleus released endogenous TRF1 from telomeres. These findings establish tankyrase 2 as a bona fide PARP, with itself and TRF1 as acceptors of ADP-ribosylation, and suggest the possibility of a role for tankyrase 2 at telomeres.
...
PMID:Role for the related poly(ADP-Ribose) polymerases tankyrase 1 and 2 at human telomeres. 1173 45

The poly(ADP-ribose) polymerase (PARP) tankyrase-1 contains an ankyrin-repeat domain that binds to various partners, including the telomeric protein TRF1 (telomere-repeat-binding factor 1) and the vesicular protein IRAP (insulin-responsive aminopeptidase). TRF1 binding recruits tankyrase-1 to telomeres and allows its PARP activity to regulate telomere homoeostasis. By contrast, IRAP binding and the Golgi co-localization of tankyrase-1 with IRAP might allow tankyrase-1 to affect the targeting of IRAP-containing vesicles. A closely related protein, tankyrase-2, has also been implicated in vesicular targeting. Unlike tankyrase-1, tankyrase-2 has not been shown to have PARP activity. In addition, it has not been implicated in telomere homoeostasis, because it did not interact with TRF1 in previous studies. Here we show that tankyrase-2 contains intrinsic PARP activity and, like tankryase-1, binds to both TRF1 and IRAP. Our analysis suggests that the ankyrin (ANK) domain of tankyrase-2 comprises five subdomains that provide redundant binding sites for IRAP. Moreover, tankyrase-2 associates and co-localizes with tankyrase-1, suggesting that both tankyrases might function as a complex. Taken together, our findings indicate that tankyrase-1 and tankyrase-2 interact with the same set of proteins and probably mediate overlapping functions, both at telomeres and in vesicular compartments.
...
PMID:Tankyrase-2 oligomerizes with tankyrase-1 and binds to both TRF1 (telomere-repeat-binding factor 1) and IRAP (insulin-responsive aminopeptidase). 1180 74

Episomal maintenance and DNA replication of EBV origin of plasmid replication (OriP) plasmid maintenance is mediated by the viral encoded origin binding protein, EBNA1, and unknown cellular factors. We found that telomeric repeat binding factor 2 (TRF2), TRF2-interacting protein hRap1, and the telomere-associated poly(ADP-ribose) polymerase (Tankyrase) bound to the dyad symmetry (DS) element of OriP in an EBNA1-dependent manner. TRF2 bound cooperatively with EBNA1 to the three nonamer sites (TTAGGGTTA), which resemble telomeric repeats. Mutagenesis of the nonamers reduced plasmid maintenance function and increased plasmid sensitivity to genotoxic stress. DS affinity-purified proteins possessed poly(ADP-ribose) polymerase (PARP) activity, and EBNA1 was subject to NAD-dependent posttranslational modification in vitro. OriP plasmid maintenance was sensitive to changes in cellular PARP/Tankyrase activity. These findings imply that telomere-associated proteins regulate OriP plasmid maintenance by PAR-dependent modifications.
...
PMID:Telomeric proteins regulate episomal maintenance of Epstein-Barr virus origin of plasmid replication. 1193 58

Poly(ADP-ribose) polymerase (PARP) is a major NAD-dependent modifying enzyme that mediates important steps in DNA repair, transcription, and apoptosis, but its role during development is poorly understood. We found that a single Drosophila Parp gene spans more than 150 kb of transposon-rich centromeric heterochromatin and produces several differentially spliced transcripts, including a novel isoform, PARP-e, predicted to encode a protein lacking enzymatic activity. An insertion mutation near the upstream promoter for Parp-e disrupts all Parp expression. Heterochromatic but not euchromatic sequences become hypersensitive to micrococcal nuclease, nucleoli fail to form, and transcript levels of the copia retrotransposon are elevated more than 50-fold; the variegated expression of certain transgenes is dominantly enhanced. Larval lethality can be rescued and PARP activity restored by expressing a cDNA encoding PARP-e. We propose that PARP-e autoregulates Parp transcription by influencing the chromatin structure of its heterochromatic environment. Our results indicate that Parp plays a fundamental role organizing the structure of Drosophila chromatin.
...
PMID:The Drosophila heterochromatic gene encoding poly(ADP-ribose) polymerase (PARP) is required to modulate chromatin structure during development. 1218 65


1 2 3 4 Next >>

---