Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:2.3.1.28 (
chloramphenicol acetyltransferase
)
5,100
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Transient transfection studies have shown that the probasin (PB) promoter confers androgen selectivity over other steroid hormones, and transgenic animal studies have demonstrated that the PB promoter will target androgen, but not glucocorticoid, regulation in a prostate-specific manner. Previous PB promoters either targeted low levels of transgene expression or became too large to be conveniently used. The goal was to design a PB promoter that would be small, yet target high levels of prostate-specific transgene expression. Thus, a composite probasin promoter (ARR2PB) coupled to the bacterial
chloramphenicol acetyltransferase
reporter (ARR2PBCAT) was generated and tested in prostatic and nonprostatic cell lines and in a transgenic mouse model. In
PC-3
, LNCaP, and DU145 prostate cancer cell lines, the ARR2PB promoter gave basal expression and was induced in response to androgen and glucocorticoid treatment after cotransfection with the respective steroid receptor. Basal expression of ARR2PBCAT in the nonprostatic COS-1, MCF-7, ZR-75-1, and PANC-1 cell lines was very low; however, CAT activity could be induced in response to androgens and glucocorticoids when cells were cotransfected with either the AR or GR. In contrast to the transfection studies, ARR2PBCAT transgene expression remained highly specific for prostatic epithelium in transgenic mice. CAT activity decreased after castration, and could be induced by androgens and, in addition, glucocorticoids. This demonstrates that the necessary sequences required to target prostate-specific epithelial expression are contained within the composite ARR2PB minimal promoter, and that high transgene expression can now be regulated by both androgens and glucocorticoids. The ARR2PB promoter represents a novel glucocorticoid inducible promoter that can be used for the generation of transgenic mouse models and in viral gene therapy vectors for the treatment of prostate cancer in humans.
...
PMID:A small composite probasin promoter confers high levels of prostate-specific gene expression through regulation by androgens and glucocorticoids in vitro and in vivo. 1110 85
Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (
PC-3
/AR). Enhancement of
chloramphenicol acetyltransferase
(
CAT
) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in
PC-3
/AR cells revealed that the enhancement of
CAT
activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.
...
PMID:Identification and characterization of two androgen response regions in the human neutral endopeptidase gene. 1116 97
The androgen receptor (AR) is a member of the steroid receptor superfamily that binds to the androgen response element to regulate target gene transcription. AR may need to interact with some selected coregulators for maximal or proper androgen function. Here we report the isolation of a new AR coregulator with a calculated molecular mass of 267 kDa named the androgen receptor-associated protein 267-alpha (ARA267-alpha). ARA267-alpha contains 2427 amino acids, including one Su(var)3-9, Enhancer-of-zeste, and Trithorax (SET) domain, two LXXLL motifs, three nuclear translocation signal (NLS) sequences, and four plant homeodomain (PHD) finger domains. Northern blot analyses reveal that ARA267-alpha is expressed predominantly in the lymph node as 13- and 10-kilobase transcripts. HepG2 is the only cell line tested that does not express ARA267-alpha. Yeast two-hybrid and glutathione S-transferase pull-down assays show that both the N and C terminus of ARA267-alpha interact with the AR DNA- and ligand-binding domains. Unlike other coregulators, such as CBP, which enhance the interaction between the N and C terminus of AR, we found that ARA267-alpha had little influence on the interaction between the N and C terminus of AR. Luciferase and
chloramphenicol acetyltransferase
assays show that ARA267-alpha can enhance AR transactivation in a dihydrotestosterone-dependent manner in
PC-3
and H1299 cells. ARA267-alpha can also enhance AR transactivation with other coregulators, such as ARA24 or PCAF, a histone acetylase, in an additive manner. Together, our data demonstrate that ARA267-alpha is a new AR coregulator containing the SET domain with an exceptionally large molecular mass that can enhance AR transactivation in prostate cancer cells.
...
PMID:Identification and characterization of a novel androgen receptor coregulator ARA267-alpha in prostate cancer cells. 1150 67
Human prostatic acid phosphatase (PAcP) is a prostate epithelium-specific differentiation antigen. The cellular form of PAcP functions as a neutral protein-tyrosine phosphatase, and is involved in regulating prostate cell growth. Although some information on the PAcP gene structure has been obtained, little is known regarding the cis- and trans-acting factors that regulate its expression. Due to the biological importance of PAcP, we investigated the regulation of its expression. A region upstream of the PAcP gene from -2899 to +87 base pairs was linked to the coding sequence of the
chloramphenicol acetyltransferase
(
CAT
) gene. Sequential deletions of the sequence between -2899 and -205 revealed that, in addition to the basic promoter, the region between -1258 and -779 represents a positive regulatory element. This -1258/-779 fragment could enhance the PAcP promoter activity in
PC-3
and DU 145 human prostate cancer cells, but not in non-prostate cancer cells, including WI-38 lung diploid cells, A-431 epidermoid carcinoma cells, and HeLa cervix epitheloid carcinoma cells. Furthermore, this cis-element together with the promoter sequence could drive a high level of expression of green fluorescent protein (GFP) in
PC-3
cells, but not in HeLa cells. The prostate-specific expression was further examined by injecting naked plasmid DNA into the prostate and the hamstring muscle of mice. The fluorescence pattern clearly showed that the level of GFP expression is consistently higher in prostate cells than in muscle cells of the intact animal. The data collectively indicate that region between -1258 and -779 is involved in governing the cell type-specific expression of the PAcP gene.
...
PMID:Identification and characterization of regulatory elements of the human prostatic acid phosphatase promoter. 1203 38
<< Previous
1
2