Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:2.3.1.28 (
chloramphenicol acetyltransferase
)
5,100
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
The purpose of this investigation was to identify and characterize the regulatory elements involved in the transcriptional activation of the beta gamma (leaky-late or gamma 1) genes of herpes simplex virus type 1 (HSV-1) by using the major capsid protein (VP5 or ICP5) gene as model. Gel mobility shift assays with nuclear extracts from uninfected and infected HeLa cells enabled us to identify two major protein-DNA complexes involving the VP5 promoter. The mobilities of these two complexes remained unaltered, and no unique complexes were observed when infected cell nuclear extracts were used. DNase I and orthophenanthroline-Cu+ footprint analyses revealed that the two complexes involve a single binding site, GGCCATCTTGAA, located between -64 and -75 bp relative to the VP5 cap site. To determine the function of this leaky-late binding site (LBS) in VP5 gene activation, we tested the effect of mutations in this region by using transient expression of a cis-linked
chloramphenicol acetyltransferase
gene. Deletion of the above sequence resulted in a seven- to eightfold reduction in the level of transactivation of the
chloramphenicol acetyltransferase
gene by superinfection with HSV-1 or by cotransfection of HSV-1 immediate-early genes. From these results, we conclude that the LBS sequence and a cellular factor(s) are involved in the transactivation of the VP5 gene. A search of published gene sequences revealed that sequences related to the LBS exist in a number of other HSV-1, cytomegalovirus, retrovirus, and cellular promoters. Sequence homologies of binding sites and results of unpublished competition binding studies suggest that this leaky-late binding factor may be related to, or the same as, a ubiquitous cellular
transcriptional factor
called YY1 or common factor-1 (also known as NF-E1, delta, and UCRBP).
...
PMID:Transactivation of the major capsid protein gene of herpes simplex virus type 1 requires a cellular transcription factor. 131 6
TR3 receptor is a human homolog of mouse Nurr77 and N10 protein and the rat NGFI-B protein. A cDNA encoding a chimeric nuclear receptor composed of the N-terminal domain and C-terminal putative ligand-binding domain of the orphan receptor TR3 receptor and the DNA-binding domain of the androgen receptor was constructed. The chimeric receptor, called TR3/AR/TR3 receptor, when expressed in COS-1 monkey kidney cells or PC-3 human prostate tumor cells, cotransfected with an ARE-containing mouse mammary tumor virus long terminal repeat-linked reporter gene encoding
chloramphenicol acetyltransferase
(
CAT
), activated
CAT
expression in the absence of any added factor. The activation was dependent on the amount of expression vector transfected and appeared to be independent of the concentration of serum supplement. Intact TR3 receptor was not active in this system. A TR3/AR/TR3 receptor protein truncated in the putative ligand-binding domain also induced
CAT
activity. TR3 receptor appears to be a
transcriptional factor
that activates transcription independently of ligand or binds an endogenous ligand present constitutively in cultured cells.
...
PMID:Transcriptional activation by TR3 receptor, a member of the steroid receptor superfamily. 184 11
Regulation of human thyrotropin beta subunit gene (TSHB) expression by thyrotropin-releasing hormone (TRH) was examined in a clonal rat pituitary-cell line (GH3). Transient expression studies were done with various 5'-flanking DNA sequences of TSHB coupled to reporter gene
chloramphenicol acetyltransferase
. Deletion analysis defined two discrete regions (-128 to -92 base pairs and -28 to +8 base pairs) that each mediated an approximately 2-fold TRH induction. The upstream site contains a DNA sequence with close homology to the DNA-binding site for a pituitary-specific
transcriptional factor
Pit-1/GHF-1. DNase I footprinting analysis of mouse thyrotropic tumor extract as well as DNA-transfection studies using an expression vector containing an N-terminal deletion of Pit-1/GHF-1 cDNA suggest that Pit-1/GHF-1 or a closely related protein in the thyrotroph mediates TRH responsiveness of this gene. In addition, the downstream site overlaps with the recently characterized thyroid hormone-inhibitory element of TSHB. In fact, deletion of DNA sequences important in thyroid hormone-receptor binding (c-erbAB/c-ERBA2) from +3 to +8 base pairs, significantly reduced (30%) TRH responsiveness. The location of a TRH-stimulatory element near a thyroid hormone-inhibitory element may allow for fine control of TSHB expression in vivo.
...
PMID:Thyrotropin-releasing hormone regulation of human TSHB expression: role of a pituitary-specific transcription factor (Pit-1/GHF-1) and potential interaction with a thyroid hormone-inhibitory element. 190 56
Fragments of 5'-flanking sequences of the human insulin receptor gene were analyzed in transient expression assays after transfection of cell lines with expression assays after transfection of cell lines with an improved low background chloramphenicol acetyl-transferase vector system pSVOOCAT (Araki, E., Shimada, F., Shichiri, M., Mori, M., and Ebina, Y. (1988) Nucleic Acids Res. 16, 1627). Transfection of chimeric
chloramphenicol acetyltransferase
plasmids containing various deletions and insertions of the promoter of HIR gene into CHO and COS cells indicated that the region between -629 and -1 (initiator ATG is +1) is sufficient for maximal promoter activity. The DNA element of the cluster of four G-C boxes (-593 to -618) enhanced the transcription, examined by the low background pSVOOCAT vector system in vivo. DNase I footprinting and gel retardation experiments using partially purified LacZ-Sp1 hybrid proteins showed that the transcription factor Sp1 can bind to the cluster of the four G-C boxes of the promoter. Thus, the efficient expression of the human insulin receptor gene possibly requires the binding of
transcriptional factor
Sp1 to four G-C boxes located -593 to -618 base pairs upstream of the ATG translation initiation codon.
...
PMID:A cluster of four Sp1 binding sites required for efficient expression of the human insulin receptor gene. 199 41
To identify the DNA sequences that cis-regulate the expression of the rat liver pyruvate kinase (L-PK) genes, a series of constructs in which the
chloramphenicol acetyltransferase
reporter genes is driven by various deleted fragments of the 3200 base pairs (bp) upstream of the L-PK gene cap site have been assayed for transient expression after introduction into hepatoma HepG2 cells, rat hepatocytes in primary culture, fibroblast LTK- cells, myogenic C2C12 cells, and CHO cells. Four distinct regulatory domains have been characterized. A proximal promoter region containing a binding site for the hepatocyte nuclear factor 1 (HNF1) which is sufficient to confer liver specificity, even in the presence of a ubiquitous enhancer. A distal promoter region (-96 to -283 bp) containing binding sites for the liver-specific factor A1 (LFA1), the ubiquitous nuclear factor 1 (NF1), the major late
transcriptional factor
(MLTF), and so far unidentified proteins binding to the L5-PK region which is essential to maximally activate expression of the construct in HepG2 cells. An extinguisher region, located between positions -2082 and -1170 bp, which decreases efficiency of the L-PK promoter in HepG2 cells, but not in hepatocytes in primary culture. Finally, a far upstream region (-2900 to -2500 bp) which seems to correspond to a liver-specific DNase I hypersensitive site and which behaves in HepG2 cells as an activating sequence efficient in the absence of the extinguisher.
...
PMID:cis-acting DNA elements regulating expression of the liver pyruvate kinase gene in hepatocytes and hepatoma cells. Evidence for tissue-specific activators and extinguisher. 201 72
By using gel mobility shift assay, it was shown that the nuclear extract from F9 embryonal carcinoma (EC) cells contains a novel transcriptional regulatory factor, BF-H, that binds to the 5' upstream region of the early gene of polyoma virus. Two binding sites were located in the transcriptional enhancer domain "A" (nucleotide 5034-5041) and in the 5' upstream of the domain "A" (4998-5005), having a consensus motif (AAPuATGG) between them. Combination of in vitro mutagenesis with
chloramphenicol acetyltransferase
(
CAT
) assay revealed that BF-H is a positive
transcriptional factor
. Interestingly, the binding of BF-H disappeared after differentiation of F9 cells by treatment with retinoic acid, whereas BF-H was present in the F9 cells differentiated with both retinoic acid and dibutyryl cyclic AMP (dbcAMP). These observations suggest that BF-H regulates the expression of genes in a developmental stage-specific manner in early embryos of the mouse.
...
PMID:A novel transcriptional regulatory factor that binds to the polyoma virus enhancer in a developmental stage-specific manner. 216 3
Nucleotide sequences that direct transcription of the human 5-lipoxygenase gene have been examined by ligation to the
chloramphenicol acetyltransferase
gene and determination of
chloramphenicol acetyltransferase
activity in transfected HeLa and HL-60 cells. Various lengths of 5'-flanking sequences up to 5.9 kilobase pairs 5' of the transcriptional initiation sites were tested. Two positive and two negative apparent regulatory regions were seen. Part of the promoter sequence (-179 to -56 from ATG), which includes five repeated GC boxes (the putative Sp1 binding sequence) was essential for transcription in both HeLa and HL-60 cells. Gel-shift assays (using the DNA fragment -212 to -88) revealed that the
transcriptional factor
Sp1 could bind to this region of the 5-lipoxygenase promoter. Furthermore, HL-60 nuclear extracts contained specific nuclear factor(s) binding to 5-lipoxygenase promoter DNA, which could not be detected in HeLa cell nuclear extracts.
...
PMID:Characterization of the human 5-lipoxygenase gene promoter. 225 Dec 50
Visna virus is a pathogenic lentivirus of sheep whose gene expression is developmentally regulated in cells of the monocyte-macrophage lineage. Gene expression directed by the visna virus long terminal repeat (LTR) is increased in infected cells by a virus-encoded trans-acting protein. trans-Activation is mediated in part by increases in the steady-state level of mRNA. Deletion and linker-scanner mutants were constructed to locate sequences in the LTR that regulate transcription and are responsive to viral trans-activation. The activities of these mutants were tested by using them to drive transcription of the bacterial gene for
chloramphenicol acetyltransferase
in transient expression assays. Three regions located between-140 and the cap site were found to be important for basal transcriptional activity, and the importance of each region was found to be dependent on the cell type. Sequences responsive to viral trans-activation were found to be the same sequences required for basal transcriptional activity. The visna virus LTR contains six sequences that are homologous to the recognition site for cellular
transcriptional factor
AP-1 and a single sequence homologous to the recognition site for
transcriptional factor
AP-4. Both of these classes of binding sites appear to be important for regulating the basal level of transcription of visna virus. The AP-1-binding site most proximal to the TATA box was found to be one target for viral trans-activation. The visna virus promoter was found to be activated by serum; this serum response has also been mapped to the AP-1-related sequences in the LTR.
...
PMID:Sequences in the visna virus long terminal repeat that control transcriptional activity and respond to viral trans-activation: involvement of AP-1 sites in basal activity and trans-activation. 254 8
The trans-acting
transcriptional factor
p40tax of human T-cell leukemia virus type I (HTLV-I) can activate expression not only of its own viral genes but also of other viral and cellular genes. We examined the cis-acting sequences in the simian virus 40 (SV40) enhancer required for its activation by HTLV-I p40tax. Experiments with
chloramphenicol acetyltransferase
constructs bearing the SV40 enhancer elements revealed that p40tax-dependent transactivation of the SV40 enhancer is mediated through the C element that contains the typical sequence for binding of a nuclear factor NF-kappa B. Activation of the C element by p40tax was seen in a limited set of cell lines as was also seen with the whole enhancer of SV40. Binding of NF-kappa B or NF-kappa B-like factor to the SV40 C element increased when p40tax was expressed. The fact that HTLV-I p40tax utilizes a cellular regulatory mechanism to transactivate the SV40 enhancer in a cell-dependent manner may have implications for the pathogenesis of adult T-cell leukemia.
...
PMID:Cell line-dependent response of the enhancer element of simian virus 40 to transactivator p40tax encoded by human T-cell leukemia virus type I. 255 45
The cis-acting regulatory sequence of transcription from long terminal repeats (LTRs) of human T-cell leukemia virus type I and type II (HTLV-I and HTLV-II), which is essential for action of the virally encoded trans-acting
transcriptional factor
(s) designated pX(s), in HTLV-I and -II was identified. Deletion of most of the U3 region of the HTLV-I LTR resulted in loss of trans-acting transcriptional activation. However, when a tandem repeat of a 21-nucleotide sequence (GAAGGCTCTGACGTCTCCCCC) that is present in the U3 region of HTLV-I and -II LTRs was inserted into the deleted U3 region of the HTLV-I LTRs,
chloramphenicol acetyltransferase
activity was restored. The extent of restoration of activity was proportional to the number of copies of the sequence inserted. To test the possibility that the 21-nucleotide sequence alone is necessary for trans-activation, a sequence (AGGAACTGAAA) homologous to a type-specific viral enhancer sequence and present in the U3 region of HTLV-II LTR, but not in the same region of the HTLV-I LTR, was inserted together with the 21-nucleotide sequence into the deleted U3 region of the HTLV-I LTR. However, no significant differences of the levels of activities of those LTRs compared to the LTRs with only the 21-nucleotide sequence repeats were observed.
...
PMID:Requirement of multiple copies of a 21-nucleotide sequence in the U3 regions of human T-cell leukemia virus type I and type II long terminal repeats for trans-acting activation of transcription. 302 80
1
2
3
Next >>