Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
 5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Genomic clones containing the 5'-terminal portion of the human CRE-BP1 gene that encodes transcriptional regulator binding to the cyclic AMP response element (CRE) were isolated. Multiple transcriptional start sites in the promoter region were identified by nuclease S1 mapping and primer extension analysis. By DNase I footprinting with use of purified transcription factor Sp1 and nuclear extracts prepared from HeLa cells, 11 Sp1-binding sites, two CCAAT sequences, two CREs, and three unknown factor recognition elements were found. Transfection of chimeric chloramphenicol acetyltransferase plasmids containing various deletions of the promoter into CV-1 cells indicated that the region between nucleotides -50 and 90, which contained three Sp1-binding sites and one CRE, was sufficient for basal promoter activity. These results suggest that multiple sequence-specific DNA-binding proteins may control the expression of the CRE-BP1 gene, although Sp1 seems to be important for the basal promoter activity.
 ...
PMID:Promoter region of the human CRE-BP1 gene encoding the transcriptional regulator binding to the cyclic AMP response element. 214 72

High level expression of the alpha-fetoprotein (AFP) gene is controlled by three upstream enhancers which function even in hepatic cell lines that repress the AFP gene promoter. The most distal ("Complex 3," at -6 kilobases) is the strongest in HepG2 cells. We mapped the main activity of Complex 3 to a 170-base pair (BP) region from -6069 to -5900; progressive deletion of the 5'- and 3'-ends identified an 84-bp segment which accounted for 90% of enhancer activity. Expression studies, which combined the deleted Complex 3 with an AFP or tk promoter chloramphenicol acetyltransferase gene fusion, resolved five regions in the enhancer (Ia, Ib, II, III, and IV). Deletion of Regions Ia or II strongly reduced stimulation of the AFP promoter, while Regions Ia and Ib were essential for stimulation of the tk promoter. Footprinting indicated multiple binding sites in regions Ia, Ib, and II. Gel shift and oligonucleotide competition demonstrated that Regions Ia and II had high affinity HNF3- and C/EBP-binding sites, respectively, while additional unidentified factors bound throughout Regions I-III. Complex 3 is a powerful liver-specific transcriptional regulator and an important model of long distance gene activation.
 ...
PMID:Characterization of the distal alpha-fetoprotein enhancer, a strong, long distance, liver-specific activator. 752 Sep 13

Wild-type (w.t.) p53 acts as a transcriptional regulator that binds to DNA and modulates transcription of several promoters. Wild-type p53 has also been shown to autoregulate its own transcription. There is no agreement, however, on whether w.t. p53 has trans-activates or downregulates its own transcription. To further explore the transcriptional autoregulation of the p53 gene, we analyzed the effect of w.t. p53 on its own promoter in different cell lines that do not express p53. A DNA domain within the human p53 promoter (-48 to -23) with the structure of ATGGGATTGGGGTTTTCCCCTCCCAT shares 8 of 10 nucleotides sequence homology with the p53 binding motif. When the human p53 promoter that included this domain was linked to a chloramphenicol acetyltransferase (CAT) gene and coexpressed with w.t. or mutated p53 in cells lacking p53 protein, w.t. p53 down-regulated its own promoter in SAOS-2 and K562 cells, but not in DP15 cells. We were unable to detect direct interaction of p53 with its promoter or to domain -48 to -23 following transfection of these cells with w.t. p53. A different pattern of protein--DNA complexes was observed, however, between the p53 promoter and nuclear extracts from SAOS-2 and DP15 cells following transfection with w.t. p53. These data suggest that w.t. p53 autoregulates its own promoter indirectly and in a cell type-specific manner.
 ...
PMID:Wild-type p53 regulates its own transcription in a cell-type specific manner. 766 53

Human c-myb is normally involved in the regulation of proliferation and differentiation of hematopoietic cells. Until now, only a few reports have described elevated c-myb gene expression in epithelial tissue, suggesting that under certain circumstances, c-Myb protein might play a role during the process of malignant transformation of epithelial cells. To investigate a possible role of c-myb during papillomavirus-associated carcinogenesis, we investigated the c-myb mRNA expression in human papillomavirus (HPV)-associated tumors and tumor cell lines. Seven of nine cervical carcinomas and two of three carcinoma cell lines exhibited elevated c-myb transcriptional activity. In contrast to malignant cervical neoplasias, only 3 of 15 condylomata acuminata expressed a sparse signal for c-myb mRNA. Since the c-Myb protein has been described as a potent transcriptional regulator, we investigated the transactivating properties of c-Myb on the HPV-16 promoter/enhancer. Cotransfection of a chloramphenicol acetyltransferase-reporter plasmid containing the HPV-16 enhancer/promoter element with a full-length c-Myb-expressing plasmid resulted in a significant induction (4.3-fold) of the HPV-16 promoter, whereas expression of a carboxy-terminally deleted c-Myb protein led to no effects. Gel shift experiments showed a specific binding of recombinant c-Myb protein on the HPV-16 P97 enhancer. These data indicate that elevated c-myb expression occurs with HPV-associated cell transformation. Since c-Myb has been shown to stimulate the HPV-derived oncoprotein expression via transcriptional activation, it may play a role in the process of HPV-associated cervical carcinogenesis.
 ...
PMID:Human c-myb is expressed in cervical carcinomas and transactivates the HPV-16 promoter. 767 Dec 56

Revealing the regulatory mechanisms involved in P-glycoprotein expression is important to our understanding of multidrug resistance (MDR) in tumor cells. The MDR1 gene encoding P-glycoprotein contained a promoter sequence (-157 to -125) that was found to be homologous with other mdr gene promoters and that specifically interacted with a nuclear protein. The nuclear protein was identified, using a HeLa lambda gt11 cDNA expression library, to be the transcriptional regulator nuclear factor for interleukin-6 (NF-IL6), a member of the C/EBP family of transcription factors that bound an NF-IL-6-like consensus element 5'-TTTCGCAGT-3'. Furthermore, a glutathione S-transferase fusion protein (10.1-glutathione S-transferase) containing the partial NF-IL6 cDNA was also found to specifically interact with the MDR1 promoter sequence. Co-transfection of an NF-IL6 expression vector with a chloramphenicol acetyltransferase reporter gene driven by 1018 base pairs of MDR1 5'-flanking sequences demonstrated that NF-IL6 trans-activated the MDR1 promoter. This trans-activation was significantly reduced when the NF-IL6 element in the reporter gene construct was deleted or mutated. Identification of NF-IL6 as an important transcriptional regulator and the implications of its potential role in MDR1 gene induction in response to a variety of stimuli are discussed.
 ...
PMID:NF-IL6, a member of the C/EBP family of transcription factors, binds and trans-activates the human MDR1 gene promoter. 796 62

The overexpression of P-glycoprotein is thought to be responsible for resistance to chemotherapy in some non-responsive cancers. The mechanism by which P-glycoprotein is overexpressed in human tumors is poorly understood. However, several lines of evidence suggest that the major regulatory mechanism of P-glycoprotein overexpression in human tumors is at the transcriptional level. During tumor progression one of the most commonly observed alterations is mutation of the p53 tumor-suppressor gene. It has been shown that the p53 protein plays a role in transcriptional regulation. To gain insight into the effect p53 protein may have on P-glycoprotein promoter activity, we transiently co-transfected plasmids containing the hamster pgp1 or human mdr1 promoter linked to the chloramphenicol acetyltransferase (CAT) reporter gene with plasmids encoding either wild-type or mutant p53 protein into Chinese hamster ovary (CHO) cells. In this report, we show that wild-type p53 protein represses P-glycoprotein promoter activity, while mutant forms of p53 protein enhance P-glycoprotein promoter activity. Furthermore, we present data which indicate that the transcriptional regulatory effects of p53 are mediated through interactions with pgp1/mdr1 core promoter sequences. These findings have implications for our understanding of the molecular mechanism(s) by which p53 protein functions as a transcriptional regulator of gene expression. In addition, our results suggest a mechanism by which P-glycoprotein may be overexpressed in human cancers that also express mutant forms of p53 protein.
 ...
PMID:The core promoter region of the P-glycoprotein gene is sufficient to confer differential responsiveness to wild-type and mutant p53. 850 78

The rat UDP glucuronosyltransferase, UGT2B1, is expressed in the liver where it glucuronidates steroids, environmental toxins, and carcinogens. A region between -88 and -111 base pairs upstream from the UGT2B1 gene transcription start site contains a CCAAT enhancer binding protein (C/EBP)-like element and was previously shown by Dnase I footprint analysis to bind to proteins in both rat liver and human hepatoma (HepG2) cell nuclear extracts. In this study, the importance of this region in the regulation of the UGT2B1 gene was assessed by functional and DNA binding assays. Varying lengths of the UGT2B1 gene promoter, with and without the C/EBP-like element, were fused to the chloramphenicol acetyltransferase reporter gene and transfected into HepG2 cells. Transcriptional activity of the UGT2B1 promoter construct containing the C/EBP-like element was strongly elevated in the presence of a cotransfected C/EBPalpha expression vector. In contrast, no change was observed when an expression vector encoding C/EBPbeta was cotransfected with the UGT2B1 promoter constructs. Introduction of point mutations into the C/EBP-like element prevented any C/EBPalpha-mediated increase in chloramphenicol acetyltransferase activity. Gel shift analyses demonstrated that the C/EBP-like element binds a complex of nuclear proteins present in both HepG2 cells and rat liver. The presence of C/EBPalpha in this complex was confirmed by supershift analysis with antiserum to this factor. These data strongly suggest that the liver-enriched factor C/EBPalpha binds to, and activates, the UGT2B1 gene promoter. The importance of C/EBPalpha in the regulation of the homologous mouse UGT2B1 gene was also assessed in vivo. Transcripts homologous to UGT2B1 were detected in the livers of mice containing intact c/ebpalpha and c/ebpbeta genes and in mice containing a homozygous null mutation in the c/ebpbeta gene. In contrast, these transcripts were not detected in mice with a disrupted hepatic c/ebpalpha gene. These data extend the findings with the rat UGT2B1 gene promoter and establish that C/EBPalpha, but not C/EBPbeta, is an essential transcriptional regulator of the homologous UGT2B1 gene in the mouse.
 ...
PMID:C/EBPalpha is a regulator of the UDP glucuronosyltransferase UGT2B1 gene. 961 4

As a transcriptional regulator, the androgen receptor (AR) regulates the expression of many genes that are essential for male sexual differentiation, including the development of both normal prostate and prostate cancer. The AR acts by binding to regulatory DNA sequences found on the promoters of regulated genes. The study of AR activity on such responsive promoters is greatly facilitated by the use of the reporter gene assay, which provides a quantitative and reproducible method for studying the activity of such promoters. Among the several reporter genes that can be used, the genes encoding luciferase (Luc) and chloramphenicol acetyltransferase (CAT) have been used most widely and successfully by researchers interested in AR-regulated promoters. Such studies have led to the identification and characterization of DNA regulatory elements mediating AR activity on responsive promoters and to an improved understanding of how AR regulates the transcription process. Described in this chapter is a method by which to generate and utilize Luc and CAT reporter gene plasmids driven by the promoter of a novel androgen-regulated gene, ETV1.
 ...
PMID:Use of reporter genes to study promoters of the androgen receptor. 1976 5

The protein encoded by HSRG1 (HSV-1 stimulation-related gene 1) is a virally induced protein expressed in HSV-1-infected cells. We have already reported that HSRG1 is capable of interacting with transcriptional regulator proteins. To further analyze the effects of HSRG1 on the regulation of viral gene transcription, we expressed the HSRG1 protein in transfected cells and found that it postpones the proliferation of HSV-1. CAT (chloramphenicol acetyltransferase) assays also revealed that HSRG1 reduces transcription from HSV-1 promoters. Yeast two-hybrid and immunoprecipitation assays indicated that HSRG1 interacts with Cyclin T2, the regulatory subunit of P-TEFb, which is required for transcription elongation by RNA Pol II (RNAP II), and that amino acid residues 1-420 in Cyclin T2 are important for binding with HSRG1. Fluorescence assays suggested that the cellular localizations of those two proteins are influenced by their interaction. Further analyses with CAT assays revealed that HSRG1 inhibits the transcriptional activation by Cyclin T2 of viral promoters. Our results suggested that the inhibitory effects of HSRG1 on viral replication and proliferation are probably induced by its binding to Cyclin T2. Therefore, it is likely that HSRG1 inhibits viral gene transcriptional elongation by interacting with Cyclin T2.
 ...
PMID:HSV-1 stimulation-related protein HSRG1 inhibits viral gene transcriptional elongation by interacting with Cyclin T2. 2150 60