Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Skeletal alpha-actin mRNA increases in the adult heart during cardiac hypertrophy after the imposition of hemodynamic overload/aortic restriction. 3,3',5-Triiodo-L-thyronine (T3) elicits a cardiac response similar to the effect of prolonged exercise and was recently shown to cause a rapid increase in the amount of skeletal alpha-actin mRNA in hearts from normal and hypophysectomized animals. We used transient transfection analysis to show that T3 induces the expression of the native skeletal alpha-actin promoter between nucleotide positions -2000 and +239 linked to the chloramphenicol acetyltransferase reporter gene in COS-1 fibroblasts and myogenic C2C12 cells. This T3 (10-100 nM)-induced transcriptional activation is dependent on the expression of the thyroid hormone receptors from transfected alpha 1 and beta 1 c-erbA complementary DNA expression vectors. Electrophoretic mobility shift assays were used to identify a thyroid hormone response element (TRE) in the human skeletal alpha-actin gene. This TRE is located between nucleotide positions -173 and -149 with respect to the start of transcription at +1 (5' TGGTCAACGCAGGGGACCCGGGCGG 3'). Electrophoretic mobility shift assay experiments showed that the putative skeletal alpha-actin TRE and defined rodent growth hormone TREs (that bind thyroid hormone receptors in vitro and in vivo) interacted with an identical nuclear factor in vitro in muscle cells that was developmentally regulated during myogenesis. Transient transfection analysis utilizing 5' unidirectional deletions of the skeletal alpha-actin promoter indicated that cis-acting sequences between nucleotide positions -432 and -153, which encompassed the TRE, were required for T3/thyroid hormone receptor-dependent trans-activation in vivo. Furthermore, we demonstrated that the skeletal alpha-actin TRE is juxtaposed next to SRF and SpI binding sites, at its 5' and 3' flanks, respectively. It is also surrounded by sequences densely populated by other SpI, SRF, and CTF binding sites. In conclusion, these results indicate that T3-induced increases in alpha-actin mRNA in animals are mediated by a direct transcriptional mechanism that may involve interactions with ubiquitous proteins.
...
PMID:The human skeletal alpha-actin promoter is regulated by thyroid hormone: identification of a thyroid hormone response element. 131 69

During continuous stimulation by agonist, beta 1- and beta 2-adrenergic receptors (ARs) undergo processes that lead to decreases in receptor expression. This receptor down-regulation serves to limit the cellular cAMP response during chronic agonist exposure. In the recently described third subtype of the beta AR, denoted beta 3AR, we found four potential cAMP response elements in the 5' flanking region, suggesting that expression of this receptor might be positively regulated by agonists. These elements were cloned into the vector pA10CAT2, which contains a chloramphenicol acetyltransferase reporter gene, and transiently expressed in VERO cells. Three of these elements, TGACTCCA, TGAGGTCT, and CGAGGTCA (located 518, 622, and 1125 bases upstream of the beta 3AR coding block, respectively) were found to increase transcription of the chloramphenicol acetyltransferase gene in response to cAMP analogues and agents that increase intracellular cAMP. 3T3-F442A cells, when differentiated into the adipocyte phenotype by insulin, expressed beta 3AR, and nuclear runoff studies from such cells confirmed cAMP enhancement of beta 3AR mRNA transcription. In these cells, beta 3AR mRNA increased in response to exposure to the beta 3AR agonist isoproterenol and remained elevated during exposures of up to 24-30 hr. During prolonged exposure to agonist, no downregulation of beta 3AR expression in 3T3-F442A cells occurred. Indeed, beta 3AR expression increased during agonist exposure to approximately 165% of basal expression. In marked contrast, beta 1AR expression declined by approximately 70% in response to chronic agonist exposure. These studies reveal a subtype-specific prolonged transcriptional regulation of a beta AR gene by the end product of its signal transduction pathway. Thus, the beta 3AR undergoes a paradoxical increase in receptor expression during chronic agonist exposure.
...
PMID:Long-term agonist exposure induces upregulation of beta 3-adrenergic receptor expression via multiple cAMP response elements. 137 4

Transforming growth factor beta (TGF-beta) isoforms inhibit the growth of many cell types and block progression of the cell cycle by inhibiting events in late G1 phase. The retinoblastoma gene product, RB, also has properties of a cell-cycle regulatory factor. It remains underphosphorylated in the presence of TGF-beta and has been shown to repress the activity of the c-fos promoter, resulting in inhibition of transit through the cell cycle. These observations led us to examine effects of human RB on the expression of the human TGF-beta 1 gene. Using chimeric TGF-beta 1 promoter-chloramphenicol acetyltransferase gene constructs, we show that RB induces TGF-beta 1 gene expression in CCL-64 mink lung epithelial cells and A-549 human lung adenocarcinoma cells but represses its expression in NIH 3T3 and AKR-2B mouse cells. Several sequences homologous to the c-fos RB control element were identified in the TGF-beta 1 promoter. These results demonstrate that human RB can regulate TGF-beta 1 gene expression negatively or positively depending on the cell type.
...
PMID:Regulation of transforming growth factor beta 1 gene expression by the product of the retinoblastoma-susceptibility gene. 190 52

Virus inducible elements (IE) in promoters of mouse alpha-interferon and human beta 1-interferon genes contain multiple copies of the hexanucleotide sequence AGT-GAA or its variants which are also found in the interferon-stimulated response element of genes transcriptionally induced by interferon. We have examined the similarities between virus and interferon induction of gene expression and the role of AGTGAA and AAT-GAA hexamers in these responses. Hybrid plasmids were constructed by inserting the IE region, the alpha 4 promoter, or the multiple copies of AGTGAA or AAT-GAA 5' to the inactive-45 human immunodeficiency-chloramphenicol acetyltransferase hybrid gene, and their inducible expression was studied in a transient expression assay. In L-cells, multiple hexamers were efficiently induced both by infection with Newcastle disease virus and by interferon treatment; while the alpha 4 promoter and the IE inducible region were induced predominantly by virus rather than by interferon. In order to dissociate the effect of virus and endogenous interferon on the induction process, we examined the gene expression in Vero cells, which have undergone homozygous deletion of type 1 interferon genes, and in VNPT-159 cells, which were derived from Vero cells by insertion of an inducible human interferon beta 1 gene. The results show that while the alpha 4 promoter was efficiently induced only by virus in both cell types, the constructs containing shorter segments of the IE were induced by both virus and interferon in Vero cells. However, the inducibility by interferon was not detected in VNPT-159 cells, suggesting that the presence of endogenous interferon suppresses interferon-induced expression of hexanucleotide repeats and the short inducible region. In contrast, virus inducibility of endogenous interferon-stimulated genes, ISG-15 and ISG-54, was about 100-fold more efficient in VNPT-159 cells than in Vero cells, suggesting that this induction is largely mediated through synthesis of endogenous interferon. Hence, endogenous interferon may play a role in the autoregulation of both interferon genes and interferon-stimulated genes.
...
PMID:Virus infection and interferon can activate gene expression through a single synthetic element, but endogenous genes show distinct regulation. 255 Apr 51

Two distinct regions of the transforming growth factor (TGF)-beta 1 promoter are responsive to autoregulation. Sequences located between nucleotides -454 to -323 and between the two major transcriptional start sites have positive regulatory activities and are induced by TGF-beta 1 in A-549 cells. The chloramphenicol acetyltransferase activity of the upstream human TGF-beta 1 promoter-chloramphenicol acetyltransferase gene is increased 8- to 10-fold by treatment of cells with TGF-beta 1, whereas that of the second promoter is increased approximately 3- to 4-fold. Using an S1 nuclease protection assay of chloramphenicol acetyl-transferase mRNA, we found that the steady-state expression of chloramphenicol acetyltransferase mRNA also is markedly increased. Seven distinct factors present in nuclear extracts from A-549 cells interact with the sequences between -454 and -323, strongly supporting the involvement of sequence-specific transcription factors in the transcriptional autoactivation of the human TGF-beta 1 gene.
...
PMID:Promoter sequences of the human transforming growth factor-beta 1 gene responsive to transforming growth factor-beta 1 autoinduction. 270 52

Cyclic mechanical strain (1 Hz) causes a mitogenic response in neonatal rat vascular smooth muscle cells due to production and secretion of PDGF. In this study, the mechanism for sensing mechanical strain was investigated. Silicone elastomer strain plates were coated at varying densities with elastin, laminin, type I collagen, fibronectin, or vitronectin. Strain was applied by cyclic application of a vacuum under the dishes. Cells adhered, spread, and proliferated on each matrix protein, but the mitogenic response to strain was matrix dependent. Strain increased DNA synthesis in cells on collagen, fibronectin, or vitronectin, but not in cells on elastin or laminin. When strain was applied on matrices containing both laminin and vitronectin, the mitogenic response to strain depended upon the vitronectin content of the matrix. Fibronectin, in soluble form (0-50 micrograms/ml), and the integrin binding peptide GRGDTP (100 micrograms/ml) both blocked the mitogenic response to mechanical strain in cells grown on immobilized collagen. Neither soluble laminin nor the inactive peptide GRGESP blocked the response to strain. GRGDTP did not alter the mitogenic response to exogenous PDGF or alpha-thrombin but did prevent the secretion of PDGF in response to strain. Furthermore, GRGDTP, but not GRGESP, prevented strain-induced expression of a PDGF-A chain promoter 890 bp-chloramphenicol acetyltransferase construct that was transiently transfected into vascular smooth muscle cells. Finally, the response to strain was abrogated by antibodies to both beta 3 and alpha v beta 5 integrins but not by an antibody to beta 1 integrins. Thus interaction between integrins and specific matrix proteins is responsible for sensing mechanical strain in vascular smooth muscle cells.
...
PMID:Mechanical strain of rat vascular smooth muscle cells is sensed by specific extracellular matrix/integrin interactions. 759 24

3,5,3,'-Triiodothyroacetic acid (Triac) has been used in therapy of resistance to thyroid hormone on an empirical basis and appears beneficial in some studies. We observed that the T3 analogs, Triac and 3,5,3'-triiodothyropropionic acid (Triprop), have a higher affinity for the thyroid hormone receptor-beta 1 (TR beta 1) than does T3 (2.7- and 1.8-fold, respectively), whereas the affinities of the three compounds for TR alpha 1 are the same. To evaluate whether T3 analogs would have a differential effect on TR beta 1 and TR beta 1 mutants and thus be a specific treatment for patients with resistance to thyroid hormone, we examined the induction of the transcriptional activation of wild-type (wt) TR alpha 1, TR beta 1, and mutant TR beta 1s by T3, Triac, and Triprop. The dose response of transcriptional activation by T3 analogs was measured by transient cotransfections with TRs and a rat malic enzyme-TRE fused to thymidine kinase (TK)-chloramphenicol acetyltransferase (CAT) in COS-1 cells. For TR alpha 1 wt, induction of CAT activity by T3 and Triac occurred at the same concentration. For TR beta 1 wt, Triac and Triprop showed a higher maximal activity than T3 (Tripro > Triac > T3) and reached 50% induction at a lower concentration than T3 (Tripro < Triac < T3). Induction of CAT activity in five mutant TR beta 1s (kindreds Mh, Mc, CL, Mf, and GH) was also analyzed. Even high levels of T3 analogs could not restore CAT activity to that of TR beta 1wt for any mutant. A dominant negative effect was produced by Mh, Mc, and Mf. Mutants CL and GH had a mild dominant negative effect depending on T3 analog concentrations and TREs. Cotransfection studies were performed using a rat malic enzyme-TK-CAT reporter plasmid to analyze the effects of hormones at near-physiological concentrations of T3 and Triac. Triac had a significantly higher transcriptional activation than T3 in Mc, CL, and GH, suggesting that Triac would have a beneficial effect to different degrees for different mutant TR beta 1s. Using mutants Mc and GH, further studies were carried out using rat GH and double palindromic and inverted palindromic TREs in COS-1 cells. On each TRE, 10 nmol/L Triac induced higher transcriptional activation in TR beta 1wt, mutant TR beta 1s, and TR beta 1wt plus mutant TR beta 1s (1:1 ratio) than the same dose of T3.(ABSTRACT TRUNCATED AT 400 WORDS)
...
PMID:Triiodothyroacetic acid has unique potential for therapy of resistance to thyroid hormone. 760 51

Effects of human retinoid X receptor alpha (hRXR alpha) and its ligand, 9-cis-retinoic acid, on T3-mediated auto-regulation of hTR beta 1 gene expression were examined using a chloramphenicol acetyltransferase (CAT) reporter system, and a deletional analysis of the promoter. hRXR alpha enhanced T3-dependent CAT induction mediated through the proximal (p) TRE in a ligand (9-cis-retinoic acid) independent manner. In a gel mobility shift assay, hRXR alpha enhanced the binding of hTR beta 1 to the pTRE by the formation of hRXR alpha-hTR beta 1 heterodimers. On the other hand, hRXR alpha and 9-cis-retinoic acid did not show any effects on T3-dependent CAT induction mediated through the distal (d) TRE or the binding of hTR beta 1 to the dTRE. A four hundred-base pair (bp) fragment adjacent upstream of the dTRE showed a T3 independent suppressor effect on the function of the pTRE and dTRE. Thus, this region may be an important regulator of the T3 dependent up-regulation of the TR beta 1 gene expression which is observed only under specific conditions.
...
PMID:Transcriptional regulation of human thyroid hormone receptor beta 1 gene expression: effect of human retinoid X receptor and identification of a transcriptional silencer region. 767 40

We investigated the role of glucocorticoids in controlling the proliferation of androgen-independent PC-3 human prostate cancer cells via the action of transforming growth factor beta 1 (TGF beta 1). The presence of glucocorticoid receptor (GR) in PC-3 cells was detected by immunoblotting analysis using a rabbit anti-GR polyclonal antibody against the synthetic human GR peptide (hGR383-393). In PC-3 cells, GR bound radiolabeled dexamethasone with an affinity similar to wild-type GR. In addition, GR-ligand complex bound radiolabeled DNA as detected by DNA band-shift analysis on gel electrophoresis and trans-activated the mouse mammary tumor virus-thymidine kinase-chloramphenicol acetyltransferase chimeric gene in transiently transfected PC-3 cells. Dexamethasone (0.1 up to 100 nM) and TGF beta 1 (0.5 up to 50 ng/ml) inhibited PC-3 cell proliferation. TGF beta 1 and dexamethasone both increased the distribution of PC-3 cells into the G1/G0 phase of the cell cycle. Platelet-derived growth factor (PDGF) stimulated the proliferation of PC-3 cells and overcame dexamethasone's inhibition of PC-3 cell growth. Dexamethasone's inhibition (10(-7) M) of PC-3 cell growth was completely neutralized by RU 486 (10(-6)M) and partly neutralized by anti-TGF beta 1 polyclonal antibody. Furthermore, dexamethasone up modulated the expression of TGF beta 1 mRNA in PC-3 cells. Because dexamethasone's inhibition was neutralized at least in part by an anti-TGF beta 1 polyclonal antibody and dexamethasone up modulated the expression of TGF beta 1 mRNA in PC-3 cells, we conclude that GR function in human PC-3 prostate cancer cells is mediated at least in part by TGF beta 1 expression.
...
PMID:Mediation of glucocorticoid receptor function by transforming growth factor beta I expression in human PC-3 prostate cancer cells. 775 11

We analyzed glucocorticoid receptor function using ligand binding assays, DNA band-shift analysis and trans-activation of the murine mammary tumor virus-thymidine kinase-chloramphenicol acetyltransferase reporter gene in transiently transfected MG-63 human osteosarcoma cells. Dexamethasone increased the distribution of MG-63 cells in the G1/G0 phase of the cell cycle, thus decreasing the rate of DNA synthesis and cell growth. Its effect on MG-63 cell growth was neutralized by RU486 and anti-transforming growth factor beta 1 (TGF beta 1) antibody. In addition, (i) dexamethasone increased the levels of active TGF beta 1 in MG-63-conditioned media without significantly altering the expression of TGF beta 1 mRNA in MG-63 cells and (ii) TGF beta 1 inhibited proliferation of MG-63 cells. Therefore, we conclude that glucocorticoid receptor function is mediated by the activation of latent-TGF beta 1 in MG-63 osteosarcoma cells.
...
PMID:Mediation of glucocorticoid receptor function by the activation of latent transforming growth factor beta 1 in MG-63 human osteosarcoma cells. 776 43


1 2 3 Next >>