Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The proximal 5'-flanking region of the alpha-subunit gene from humans and cattle confers pituitary-specific expression to heterologous reporter genes in transgenic mice. To investigate whether these promoter regions also contain the necessary regulatory elements for cell-specific expression and hormonal regulation, we used three independent lines of transgenic mice. Two lines of transgenic mice contained chimeric genes consisting of either 1.6 kilobasepairs (kbp) of human or 3 15 basepairs of bovine alpha-subunit proximal 5'-flanking sequence linked to the bacterial gene encoding chloramphenicol acetyltransferase (CAT). A third line of transgenic mice contained the proximal 1.6 kbp of 5'-flanking sequence of the human alpha-subunit gene linked to the bacterial lacZ gene encoding beta-galactosidase (beta gal; H alpha beta gal transgenic mice). Hormonal replacement paradigms indicate that both human and bovine alpha CAT transgenes are regulated by GnRH, suggesting that their expression occurs in gonadotropes. Thus, the proximal 5'-flanking regions of both the human and bovine alpha-subunit genes must contain regulatory elements that confer both gonadotrope-specific expression and responsiveness to GnRH. In contrast to the human alpha-subunit promoter, the bovine alpha-subunit promoter lacks a functional cAMP response element, suggesting that transduction of both cell-specific and GnRH transcriptional signals occurs through cAMP response element-independent pathways. Thyrotropes also express the glycoprotein hormone alpha-subunit gene. Yet, hormone replacement paradigms with propylthiouracil and T3 were ineffective in altering CAT activity in the pituitary of human or bovine alpha CAT transgenic mice. Because a thyroid hormone response element has been localized to the proximal 5'-flanking region of the human alpha-subunit gene, these data suggest that the alpha CAT transgenes lack sufficient information to direct expression to thyrotropes. Direct evidence for this possibility was obtained through immunocytochemical studies performed on pituitaries from H alpha beta gal transgenic mice. beta-Galactosidase activity appeared in gonadotropes, but not thyrotropes. We conclude, therefore, that distinct and separable regulatory elements mediate the expression of the alpha-subunit gene in gonadotropes and thyrotropes.
...
PMID:Gonadotrope- and thyrotrope-specific expression of the human and bovine glycoprotein hormone alpha-subunit genes is regulated by distinct cis-acting elements. 128 Mar 29

Skeletal alpha-actin mRNA increases in the adult heart during cardiac hypertrophy after the imposition of hemodynamic overload/aortic restriction. 3,3',5-Triiodo-L-thyronine (T3) elicits a cardiac response similar to the effect of prolonged exercise and was recently shown to cause a rapid increase in the amount of skeletal alpha-actin mRNA in hearts from normal and hypophysectomized animals. We used transient transfection analysis to show that T3 induces the expression of the native skeletal alpha-actin promoter between nucleotide positions -2000 and +239 linked to the chloramphenicol acetyltransferase reporter gene in COS-1 fibroblasts and myogenic C2C12 cells. This T3 (10-100 nM)-induced transcriptional activation is dependent on the expression of the thyroid hormone receptors from transfected alpha 1 and beta 1 c-erbA complementary DNA expression vectors. Electrophoretic mobility shift assays were used to identify a thyroid hormone response element (TRE) in the human skeletal alpha-actin gene. This TRE is located between nucleotide positions -173 and -149 with respect to the start of transcription at +1 (5' TGGTCAACGCAGGGGACCCGGGCGG 3'). Electrophoretic mobility shift assay experiments showed that the putative skeletal alpha-actin TRE and defined rodent growth hormone TREs (that bind thyroid hormone receptors in vitro and in vivo) interacted with an identical nuclear factor in vitro in muscle cells that was developmentally regulated during myogenesis. Transient transfection analysis utilizing 5' unidirectional deletions of the skeletal alpha-actin promoter indicated that cis-acting sequences between nucleotide positions -432 and -153, which encompassed the TRE, were required for T3/thyroid hormone receptor-dependent trans-activation in vivo. Furthermore, we demonstrated that the skeletal alpha-actin TRE is juxtaposed next to SRF and SpI binding sites, at its 5' and 3' flanks, respectively. It is also surrounded by sequences densely populated by other SpI, SRF, and CTF binding sites. In conclusion, these results indicate that T3-induced increases in alpha-actin mRNA in animals are mediated by a direct transcriptional mechanism that may involve interactions with ubiquitous proteins.
...
PMID:The human skeletal alpha-actin promoter is regulated by thyroid hormone: identification of a thyroid hormone response element. 131 69

To examine the role of nuclear retinoic acid (RA) receptors (RARs) in the regulation of squamous differentiation in normal human epidermal keratinocytes (NHEK), we analyzed binding activity, mRNA expression, and transcriptional activity of the endogenously expressed RARs. Specific RA-binding activity eluted from size-exclusion HPLC with an apparent mol wt of 50 kilodaltons and was predominantly (greater than 95%) associated with the NHEK nuclear cell fraction. This RAR-binding activity represented in part the expression of RAR alpha and RAR gamma genes, whose transcripts were expressed in similar abundance in undifferentiated NHEK. Differentiation resulted in lower mRNA expression of RAR alpha relative to the mRNA expression of RAR gamma. Treatment of NHEK cells with 10(-6) M RA did not induce expression of RAR beta mRNA. Similarly, three squamous cell carcinoma cell lines derived from human skin and oral cavity expressed RAR alpha and RAR gamma transcripts, but not RAR beta transcripts. Transfection of NHEK with chloramphenicol acetyltransferase (CAT) reporter plasmids indicated that the endogenously expressed RARs could activate transcription through the RAR beta response element in a concentration-dependent manner with doses of 10(-9) M RA and higher. CAT expression was not activated through TRE, a palindromic thyroid hormone response element with purported RA responsiveness. The competitive binding of benzoic acid derivatives of RA to RAR correlated with the ability of each analog to suppress mRNA expression of the squamous cell markers, involucrin, type I transglutaminase, and SQ37, and to activate transcription of the RAR beta response element-CAT reporter. These results demonstrate that the control of NHEK differentiation by RA is consistent with the interaction of the retinoid with RAR and the regulation of transcription by that ligand-receptor complex.
...
PMID:Retinoic acid receptors as regulators of human epidermal keratinocyte differentiation. 131 2

The ability of a retinoic acid (RA) response element (RARE) in the phosphoenolpyruvate carboxykinase (PEPCK) gene promoter to mediate effects of either RA or thyroid hormone (T3) on gene expression was studied. Fusion gene constructs consisting of PEPCK promoter sequences ligated to the chloramphenicol acetyltransferase (CAT) reporter gene were used for this analysis. While T3 induced CAT expression to a small degree (about twofold) when such constructs were transiently transfected into H4IIE rat hepatoma cells, along with an expression vector encoding the alpha subtype of the T3 receptor (TR), this effect was mediated by promoter sequences distinct from the PEPCK RARE. Although TRs were capable of binding the PEPCK RARE in the form of putative monomers, dimers, and heterodimers with RA receptors (RARs), this element failed to mediate any positive effect of T3 on gene expression. In contrast, the PEPCK RARE mediated six- to eightfold induction of CAT expression by RA. When TRs were coexpressed along with RARs in transfected H4IIE cells, this RA induction was substantially blunted in a T3-independent manner. This inhibitory effect may be due to the binding of nonfunctional TRs or TR-RAR heterodimers to the PEPCK RARE. A model is proposed to explain the previously observed in vivo effects of T3 on PEPCK gene expression.
...
PMID:Specificity of a retinoic acid response element in the phosphoenolpyruvate carboxykinase gene promoter: consequences of both retinoic acid and thyroid hormone receptor binding. 194 93

The effects of thyroid hormone on expression of cardiac myosin heavy chain genes generally are thought to be mediated by nuclear 3,5,3'-triiodo-L-thyronine (T3) receptors that have been identified as the products of the protooncogene, c-erbA. This hypothesis has been tested by transfection of cardiomyocytes in primary culture with a plasmid, pRSVhEACAT-, expressing anti-sense c-erbA mRNA. Because only a low percentage of cells (20%) could be transfected in primary culture an alpha-myosin heavy chain-chloramphenicol acetyltransferase fusion construct was used as a reporter gene. The results indicate that the anti-sense plasmid almost completely blocks T3-induced activity of the reporter gene (less than 1% control) while transfection of a similar amount of the sense construct, pRSVhEACAT+, has no effect. When the c-erbA plasmids were cotransfected with constructs containing T3-independent promoters, no effects on expression were observed. The combined use of an anti-sense construct and a report gene provides a means of studying the role of c-erbA products in intracellular signal transduction even in differentiated, nondividing cells like those of the heart.
...
PMID:An anti-sense c-erbA clone inhibits thyroid hormone-induced expression from the alpha-myosin heavy chain promoter. 169 Jul 29

Regulation of myelin basic protein (MBP) gene expression by thyroid hormone has been investigated in rodent brain. Quantitation of the 4 major alternatively spliced transcripts by RNase protection assay showed that the individual mRNAs, corresponding to MBP isoforms 21.5, 18.5, 17, and 14 kDa, were decreased from 2- to 17-fold at all ages studied (4-60 days) in hypothyroid animals when compared to euthyroid, but the timing of onset of expression was not altered. MBP mRNA was also reduced in young adult rats thyroidectomized at the age of 5-6 weeks and was restored to normal by thyroxine administration. Nuclear run-off assays showed that the rate of MBP gene transcription is dependent on thyroid state. Co-transfection of MBP (-256/+1)-chloramphenicol acetyltransferase chimeric gene with a plasmid expressing thyroid hormone receptor alpha, and in the presence of 3,5,3'-triiodothyronine, into NIH3T3 or NG108-15, increased chloramphenicol acetyltransferase expression 4-fold. Using a footprinting technique and Spodoptera frugiperda 9 (Sf9) nuclear extract infected with baculovirus expressing TR alpha, we have identified a single DNA-binding site (-186/-163) for the receptor. A part of this region contains the AGGACA sequence found in thyroid hormone-responsive elements of other 3,5,3'-triiodothyronine-regulated genes. Our finding of a specific hormone-receptor interaction with the MBP promoter region is the first direct demonstration of a thyroid hormone-responsive element in a brain-specific gene.
...
PMID:Molecular basis of thyroid hormone regulation of myelin basic protein gene expression in rodent brain. 172 Jul 78

The mRNA encoding the sarcoplasmic reticulum (SR) Ca2+ ATPase is highly influenced by thyroid hormone (T3) in the hearts of intact animals. We show here that this effect of T3 can be mimicked in primary neonatal rat cardiocytes, both in serum-containing and in serum-free media; the expression of SR Ca2+ ATPase mRNA is myocyte-specific and is also modulated by retinoic acid (RA). RA also induces myosin heavy chain (MHC) alpha-mRNA in this system. The induction of Ca2+ ATPase mRNA is sensitive to T3 (EC50 approximately 30 pM) and less sensitive to RA (EC50 approximately 2 nM). Transient transfection experiments utilizing various segments of the Ca2+ATPase promoter fused to the reporter gene chloramphenicol acetyltransferase (CAT) indicate a minimal thyroid hormone response element (TRE) between nucleotides -262 and -322, while sequences between -322 and -559 are required for maximal trans-activation. RA is not able to regulate these constructs. Likewise, a clear effect of T3 but no effect of RA was observed when the CAT gene was driven by a TRE derived from the rat alpha-MHC gene. In contrast, CAT expression was induced by either hormone when placed under the control of a synthetic palindromic TRE. Taken together, these results indicate that T3 and RA induce gene expression in primary cardiac myocytes, but through distinct response elements and/or mechanisms.
...
PMID:Influence of thyroid hormone and retinoic acid on slow sarcoplasmic reticulum Ca2+ ATPase and myosin heavy chain alpha gene expression in cardiac myocytes. Delineation of cis-active DNA elements that confer responsiveness to thyroid hormone but not to retinoic acid. 182 23

Previous work from this laboratory demonstrated that 17-beta estradiol (E2) can directly stimulate the transcription rate of the rat luteinizing hormone beta (LH beta) gene and that an upstream portion of the LH beta gene between -2.0 and -0.6 kilobases could confer an E2-stimulated response to a reporter gene in transient expression assays. To localize the LH beta estrogen response element (ERE) by biological function, portions of the 5'-flanking region of the LH beta gene or synthetic oligonucleotides were inserted in expression vectors next to the herpes simplex virus thymidine kinase promoter fused to the chloramphenicol acetyltransferase gene. Constructs were transfected into GH3 cells, and transfected cells were treated for 48 h with E2. E2 stimulation of activity (2-4-fold) occurred with constructs containing the 15-base pair palindromic sequence (GGACACCATCTGTCC), found at bases -1173 to -1159 relative to the transcriptional start site in the LH beta gene. A construct containing a synthetic oligonucleotide of this putative LH beta ERE was stimulated 1.7-3-fold by E2, while a construct containing two copies of the sequence was stimulated to a slightly higher level (2.5-4.0-fold). An oligonucleotide in which the palindrome was mutated failed to confer E2 stimulation, and mutation of the palindromic region within the upstream region of the LH beta gene also eliminated the E2 response. The anti-estrogen tamoxifen could not elicit a response, nor could dehydrotestosterone or dexamethasone; however, thyroid hormone treatment resulted in a 2-2.5-fold stimulation. The 15-base pair LH beta gene palindrome was found to bind estrogen receptor (ER) complex directly by gel retardation experiments. Labeled LH beta ERE DNA formed three complexes with proteins from immature rat uterine extract. Two of these were associated with ER complexes, as determined by the comigration of [3H] estradiol bound to ER with these complexes, and by the ability of anti-ER antibody to associate with these complexes. The affinity of the LH beta ERE for ER was calculated by Scatchard analysis to be 2.2-5.0 nM, an approximately 5-10-fold lower affinity than for the ERE in the vitellogenin A2 gene region. The mutated ERE, which had no biological activity, could not compete effectively for binding to ER. ER which was heat-transformed at 30 degrees C had a similar affinity (2-5 nM) for the ERE as ER occupied with E2 (2-4 nM), while ER occupied by estrone had a lower affinity (9 nM).(ABSTRACT TRUNCATED AT 400 WORDS)
...
PMID:Identification of an estrogen-responsive element in the rat LH beta gene. DNA-estrogen receptor interactions and functional analysis. 189 4

Regulation of human thyrotropin beta subunit gene (TSHB) expression by thyrotropin-releasing hormone (TRH) was examined in a clonal rat pituitary-cell line (GH3). Transient expression studies were done with various 5'-flanking DNA sequences of TSHB coupled to reporter gene chloramphenicol acetyltransferase. Deletion analysis defined two discrete regions (-128 to -92 base pairs and -28 to +8 base pairs) that each mediated an approximately 2-fold TRH induction. The upstream site contains a DNA sequence with close homology to the DNA-binding site for a pituitary-specific transcriptional factor Pit-1/GHF-1. DNase I footprinting analysis of mouse thyrotropic tumor extract as well as DNA-transfection studies using an expression vector containing an N-terminal deletion of Pit-1/GHF-1 cDNA suggest that Pit-1/GHF-1 or a closely related protein in the thyrotroph mediates TRH responsiveness of this gene. In addition, the downstream site overlaps with the recently characterized thyroid hormone-inhibitory element of TSHB. In fact, deletion of DNA sequences important in thyroid hormone-receptor binding (c-erbAB/c-ERBA2) from +3 to +8 base pairs, significantly reduced (30%) TRH responsiveness. The location of a TRH-stimulatory element near a thyroid hormone-inhibitory element may allow for fine control of TSHB expression in vivo.
...
PMID:Thyrotropin-releasing hormone regulation of human TSHB expression: role of a pituitary-specific transcription factor (Pit-1/GHF-1) and potential interaction with a thyroid hormone-inhibitory element. 190 56

We previously showed that the 5'-flanking region of the malic enzyme (ME) gene contains a cis-regulatory element (-281 to -261) that binds thyroid hormone receptors and confers triiodothyronine (T3) inducibility of transcription to the ME promoter (Petty, K.J., Desvergne, B., Mitsuhashi, T., and Nikodem, V. M. (1990) J. Biol. Chem. 265, 7395-7400). In this report, we have used deletion and mutation analyses of the ME thyroid hormone response element (TRE) to evaluate the roles of several subregions of TRE in T3 binding and transactivation. ME TRE was shown to act as an enhancer conferring T3 responsiveness to a heterologous promoter thymidine kinase. Although T3 treatment induced the promoter activity, the absence of hormone resulted in repression as measured by the level of chloramphenicol acetyltransferase expression in the NIH 3T3 transient expression system in the presence of overexpressed receptor. The degree of repression was similar to the degree of T3 induction observed for the same TRE mutants. Mutation and deletion analyses indicated that the functional TRE is comprised of discrete regions that are not contiguous, with a dominant role of a cluster of G residues and an AGGACA sequence. Both functions, induction and repression of transcription, correlated with receptor binding to the ME TRE as determined by competition binding assays using wild type and mutated TRE as competitors.
...
PMID:Functional characterization and receptor binding studies of the malic enzyme thyroid hormone response element. 198 29


1 2 3 4 5 6 Next >>

---