Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Skeletal alpha-actin mRNA increases in the adult heart during cardiac hypertrophy after the imposition of hemodynamic overload/aortic restriction. 3,3',5-Triiodo-L-thyronine (T3) elicits a cardiac response similar to the effect of prolonged exercise and was recently shown to cause a rapid increase in the amount of skeletal alpha-actin mRNA in hearts from normal and hypophysectomized animals. We used transient transfection analysis to show that T3 induces the expression of the native skeletal alpha-actin promoter between nucleotide positions -2000 and +239 linked to the chloramphenicol acetyltransferase reporter gene in COS-1 fibroblasts and myogenic C2C12 cells. This T3 (10-100 nM)-induced transcriptional activation is dependent on the expression of the thyroid hormone receptors from transfected alpha 1 and beta 1 c-erbA complementary DNA expression vectors. Electrophoretic mobility shift assays were used to identify a thyroid hormone response element (TRE) in the human skeletal alpha-actin gene. This TRE is located between nucleotide positions -173 and -149 with respect to the start of transcription at +1 (5' TGGTCAACGCAGGGGACCCGGGCGG 3'). Electrophoretic mobility shift assay experiments showed that the putative skeletal alpha-actin TRE and defined rodent growth hormone TREs (that bind thyroid hormone receptors in vitro and in vivo) interacted with an identical nuclear factor in vitro in muscle cells that was developmentally regulated during myogenesis. Transient transfection analysis utilizing 5' unidirectional deletions of the skeletal alpha-actin promoter indicated that cis-acting sequences between nucleotide positions -432 and -153, which encompassed the TRE, were required for T3/thyroid hormone receptor-dependent trans-activation in vivo. Furthermore, we demonstrated that the skeletal alpha-actin TRE is juxtaposed next to SRF and SpI binding sites, at its 5' and 3' flanks, respectively. It is also surrounded by sequences densely populated by other SpI, SRF, and CTF binding sites. In conclusion, these results indicate that T3-induced increases in alpha-actin mRNA in animals are mediated by a direct transcriptional mechanism that may involve interactions with ubiquitous proteins.
...
PMID:The human skeletal alpha-actin promoter is regulated by thyroid hormone: identification of a thyroid hormone response element. 131 69

The zif268 gene, which encodes a protein with three typical zinc finger sequences, is induced in mouse 3T3 cells by serum, phorbol 12-myristate 13-acetate platelet-derived growth factor, and fibroblast growth factor. The induction is coordinate with that of c-fos. The 5'-flanking region of zif268 contains sequences that resemble known regulatory elements, including four CC(A or T)6GG sequences similar to the core serum response elements (SREs) found upstream of c-fos and actin genes. To determine whether the zif268 SRE-like elements mediate induction, CAT (chloramphenicol acetyltransferase) plasmids with different lengths of zif268 upstream sequences were tested for inducibility in 3T3 cells by serum, platelet-derived growth factor, or phorbol 12-myristate 13-acetate. In addition, double-stranded oligonucleotides corresponding to each of the four zif268 putative SREs were tested individually for responsiveness when placed upstream of a thymidine kinase gene promoter. Each of the four SREs conferred inducibility by the agents tested, and multiple SREs resulted in greater inducibility than did a single element. Each of the zif268 SREs also competed with the c-fos SRE for binding by serum response factor present in HeLa cell nuclear extract. We conclude that the zif268 SRE-like sequences are functional and probably account for the coordinate induction of zif268 and c-fos.
...
PMID:Functional serum response elements upstream of the growth factor-inducible gene zif268. 251 79

The mouse myosin light-chain 1A (MLC1A) gene, expressed in the atria of the adult heart, is one of the first muscle genes to be activated when skeletal as well as cardiac muscles form in the embryo. It is also transcribed in skeletal muscle cell lines at the onset of differentiation. Transient transfection assays of mouse skeletal muscle cell lines with DNA constructs containing MLC1A promoter fragments fused to the chloramphenicol acetyltransferase (CAT) gene show that the first 630 bp of the promoter is sufficient to direct expression of the reporter gene during myotube formation. Two E boxes located at bp -76 and -519 are necessary for this regulation. MyoD and myogenin proteins bind to them as heterodimers with E12 protein and, moreover, transactivate them in cotransfection experiments with the MLC1A promoter in nonmuscle cells. Interestingly, the effect of mutating each E box is less striking in primary cultures than in the C2 or Sol8 muscle cell line. A DNA fragment from bp -36 to -597 confers tissue- and stage-specific activity to the herpes simplex virus thymidine kinase promoter in both orientations, showing that the skeletal muscle-specific regulation of the MLC1A gene is under the control of a muscle-specific enhancer which extends into the proximal promoter region. At bp -89 is a diverged CArG box, CC(A/T)6AG, which binds the serum response factor (SRF) in myotube nuclear extracts, as does the wild-type sequence, CC(A/T)6GG. Both types of CArG box also bind a novel myotube-enriched complex which has contact points with the AT-rich part of the CArG box and adjacent 3' nucleotides. Mutations within the CArG box distinguish between the binding of this complex and binding of SRF; only SRF binding is directly involved in the specific regulation of the MLC1A gene in skeletal muscle cell lines.
...
PMID:A skeletal muscle-specific enhancer regulated by factors binding to E and CArG boxes is present in the promoter of the mouse myosin light-chain 1A gene. 762 50

The present studies have examined the effects of pokeweed mitogen (PWM) on the induction of early growth response-1 gene (EGR-1) in normal human B cells. PWM regulates EGR-1 gene expression by both transcriptional and post-transcriptional mechanisms. Transient transfection assays with EGR-1 promoter fragments linked to the chloramphenicol acetyltransferase (CAT) gene demonstrated that PWM induced EGR-1 transcription is conferred by the CArG motif (C C[AT]6GG) in the EGR-1 promoter. The results further demonstrated the activation of S6 kinase (pp90rsk), evidenced by phosphorylation of S6 and serum response factor (SRF) peptides, in PWM treated B cells. Taken together, these findings suggest that PWM is able to initiate an intracytoplasmic signalling cascade and EGR-1 induction in normal human B cells.
...
PMID:Activation of pp90rsk and early growth response-1 gene expression by pokeweed mitogen in human B cells. 776 34

Receptor-bound growth factors elicit intracellular signals that lead to the phosphorylation and activation of numerous intracellular kinases and transcription factors with consequent changes in patterns of gene expression. Several oncogene products are able to mimic these signals, resulting in cell transformation and proliferation. For example, the introduction of oncogenic forms of Raf-1 kinase into fibroblasts induces transformation and leads to the constitutive expression of, among others, the c-fos proto-oncogene. Here it is shown that the elevation of c-fos promoter activity brought about by v-raf is mediated by TCF/Elk-1, which forms a ternary complex with SRF at the serum response element and is a substrate for mitogen-activating protein kinases in vitro. In NIH 3T3 fibroblasts, v-raf activates Erk2, and overexpression of an interfering mutant of Erk2 both blocks the ability of v-raf to activate the c-fos promoter and suppresses transformation. Mutation of individual mitogen-activating protein kinase phosphoacceptor sites in TCF/Elk-1 also compromises v-raf-activated expression of a Gal-Elk/Gal-chloramphenicol acetyltransferase reporter system. However, in at least one instance the introduction of glutamate, but not aspartate, at a phosphoacceptor site is compatible with activation. These results provide compelling evidence that phosphorylation of TCF/Elk-1 by Erk2 is a major link in the Raf-1 kinase-dependent signal transduction pathway that activates c-fos expression.
...
PMID:Inhibition of v-raf-dependent c-fos expression and transformation by a kinase-defective mutant of the mitogen-activated protein kinase Erk2. 800 80

The murine alpha B-crystallin/small heat shock protein gene is expressed at high levels in the lens and at lower levels in the heart, skeletal muscle, and numerous other tissues. Previously we have found a skeletal-muscle-preferred enhancer at positions -427 to -259 of the alpha B-crystallin gene containing at least four cis-acting regulatory elements (alpha BE-1, alpha BE-2, alpha BE-3, and MRF, which has an E box). Here we show that in transgenic mice, the alpha B-crystallin enhancer directs the chloramphenicol acetyltransferase reporter gene driven by the alpha B-crystallin promoter specifically to myocardiocytes of the heart. The alpha B-crystallin enhancer was active in conjugation with the herpes simplex virus thymidine kinase promoter/human growth hormone reporter gene in transfected rat myocardiocytes. DNase I footprinting and site-specific mutagenesis experiments showed that alpha BE-1, alpha BE-2, alpha BE-3, MRF, and a novel, heart-specific element called alpha BE-4 are required for alpha B-crystallin enhancer activity in transfected myocardiocytes. By contrast, alpha BE-4 is not utilized for enhancer activity in transfected lens or skeletal muscle cell lines. Alpha BE-4 contains an overlapping heat shock sequence and a reverse CArG box [5'-GG(A/T)6CC-3']. Electrophoretic mobility shift assays with an antibody to serum response factor and a CArG-box-competing sequence from the c-fos promoter indicated that a cardiac-specific protein with DNA-binding and antigenic similarities to serum response factor binds to alpha BE-4 via the reverse CArG box; electrophoretic mobility shift assays and antibody experiments with anti-USF antiserum and heart nuclear extract also raised the possibility that the MRF E box utilizes USF or an antigenically related protein. We conclude that the activity of the alpha B-crystallin enhancer in the heart utilizes a reverse CArG box and an E-box-dependent pathway.
...
PMID:Regulation of the murine alpha B-crystallin/small heat shock protein gene in cardiac muscle. 852 75

The Tax protein of human T-cell lymphotropic virus type 1 (HTLV-1) is a 40-kDa transcriptional activator which is critical for HTLV-1 gene regulation and virus-induced cellular transformation. Tax is localized to the DNA through its interaction with the site-specific activators cyclic AMP-responsive element-binding protein, NF-kappaB, and serum response factor. It has been suggested that the recruitment of Tax to the DNA positions Tax for interaction with the basal transcriptional machinery. On the basis of several independent assays, we now report a physical and functional interaction between Tax and the transcription factor, TFIIA. First, Tax was found to interact with the 35-kDa (alpha) subunit of TFIIA in the yeast two-hybrid interaction system. Importantly, two previously characterized mutants with point mutations in Tax, M32 (Y196A, K197S) and M41 (H287A, P288S), which were shown to be defective in Tax-activated transcription were unable to interact with TFIIA in this assay. Second, a glutathione-S-transferase (GST) affinity-binding assay showed that the interaction of holo-TFIIA with GST-Tax was 20-fold higher than that observed with either the GST-Tax M32 activation mutant or the GST control. Third, a coimmunoprecipitation assay showed that in HTLV-1-infected human T lymphocytes, Tax and TFIIA were associated. Finally, TFIIA facilitates Tax transactivation in vitro and in vivo. In vitro transcription studies showed reduced levels of Tax-activated transcription in cell extracts depleted of TFIIA. In addition, transfection of human T lymphocytes with TFIIA expression vectors enhanced Tax-activated transcription of an HTLV-1 long terminal repeat-chloramphenicol acetyltransferase reporter construct. Our study suggests that the interaction of Tax with the transcription factor TFIIA may play a role in Tax-mediated transcriptional activation.
...
PMID:Interaction of the human T-cell lymphotropic virus type 1 tax transactivator with transcription factor IIA. 875 22

Cytomegalovirus (CMV) infection is nonpermissive or persistent in many lymphoid and myeloid cell types but can be activated in differentiated macrophages. We have shown elsewhere that both the major immediate-early gene (MIE) and lytic cycle infectious progeny virus expression can be induced in otherwise nonpermissive monocyte-like U-937 cell cultures infected with either human CMV (HCMV) or simian CMV (SCMV) by treatment with the phorbol ester 12-O-tetradecanoylphorbol-13-acetate (TPA). Two multicopy basal enhancer motifs within the SCMV MIE enhancer, namely, 11 copies of the 16-bp cyclic AMP response element (CRE) and 3 copies of novel 17-bp serum response factor (SRF) binding sites referred to as the SNE (SRF/NFkappaB-like element), as well as four classical NFkappaB sites within the HCMV version, contribute to TPA responsiveness in transient assays in monocyte and T-cell types. The SCMV SNE sites contain potential overlapping core recognition binding motifs for SRF, Rel/NFkappaB, ETS, and YY1 class transcription factors but fail to respond to either serum or tumor necrosis factor alpha. Therefore, to evaluate the mechanism of TPA responsiveness of the SNE motifs and of a related 16-bp SEE (SRF/ETS element) motif found in the HCMV and chimpanzee CMV MIE enhancers, we have examined the functional responses and protein binding properties of multimerized wild-type and mutant elements added upstream to the SCMV MIE or simian virus 40 minimal promoter regions in the U-937, K-562, HL-60, THP-1, and Jurkat cell lines. Unlike classical NFkappaB sites, neither the SNE nor the SEE motif responded to phosphatase inhibition by okadaic acid. However, the TPA responsiveness of both CMV elements proved to involve synergistic interactions between the core SRF binding site (CCATATATGG) and the adjacent inverted ETS binding motifs (TTCC), which correlated directly with formation of a bound tripartite complex containing both the cellular SRF and ELK-1 proteins. This protein complex was more abundant in U-937, K-562, and HeLa cell extracts than in Raji, HF, BALB/c 3T3, or HL-60 cells, but the binding activity was altered only twofold after TPA treatment. A 40-fold stimulation of chloramphenicol acetyltransferase activity mediated by four tandem repeats of the SNE could be induced within 2 h (and up to 250-fold within 6 h) after addition of TPA in DNA-transfected U-937 cells, indicating that the stimulation appeared likely to be a true protein kinase C-mediated signal transduction event rather than a differentiation response. Slight differences in the sequence of the core SRF binding site compared with that of the classical c-Fos promoter serum response element, together with differences in the spacing between the SRF and ETS motifs, appear to account for the inability of the SCMV SNEs to respond to serum induction.
...
PMID:Synergistic interactions between overlapping binding sites for the serum response factor and ELK-1 proteins mediate both basal enhancement and phorbol ester responsiveness of primate cytomegalovirus major immediate-early promoters in monocyte and T-lymphocyte cell types. 897 Sep 84

The goal of the present study was to determine the molecular mechanism whereby transforming growth factor beta (TGFbeta) increases smooth muscle (SM) alpha-actin expression. Confluent, growth-arrested rat aortic smooth muscle cells (SMC) were transiently transfected with various SM alpha-actin promoter/chloramphenicol acetyltransferase deletion mutants and stimulated with TGFbeta (2.5 ng/ml). Results demonstrated that the first 125 base pairs of the SM alpha-actin promoter were sufficient to confer TGFbeta responsiveness. Three cis elements were shown to be required for TGFbeta inducibility: two highly conserved CArG boxes, designated A (-62) and B (-112) and a novel TGFbeta control element (TCE) (-42). Mutation of any one of these elements completely abolished TGFbeta-induced reporter activity. Results of electrophoretic mobility shift assays demonstrated that nuclear extracts from TGFbeta-treated SMC enhanced binding activity of serum response factor to the CArG elements and binding of an as yet unidentified factor to the TCE. Northern analysis showed that TGFbeta also stimulated transcription of two other SM (SM myosin heavy chain) differentiation marker genes, SM myosin heavy chain and h1 calponin, whose promoters also contained a TCE-like element. In summary, we identified a TGFbeta response element in the SM alpha-actin promoter that may contribute to coordinate regulation of expression of multiple cell-type specific proteins during SMC differentiation.
...
PMID:A transforming growth factor beta (TGFbeta) control element drives TGFbeta-induced stimulation of smooth muscle alpha-actin gene expression in concert with two CArG elements. 909 54

The objective of the present study was to examine the molecular mechanisms whereby angiotensin II (Ang II) stimulates smooth muscle (SM) alpha-actin expression in rat aortic smooth muscle cells (SMCs). Nuclear run-on analysis and transfection studies indicated that the effects of Ang II on SM alpha-actin were mediated at least in part at the transcriptional level. Transfection of various rat SM alpha-actin promoter/chloramphenicol acetyltransferase (CAT) constructs into SMCs demonstrated that the first 155 bp of the SM alpha-actin promoter was sufficient to confer maximal Ang II responsiveness, conferring an approximately 4-fold increase in reporter activities in these SMCs compared with vehicle-treated SMCs. Mutation of either of two highly conserved CArG elements, designated A (-62) and B (-112), completely abolished Ang II-induced increases in reporter activity, whereas mutation of a homeodomain-like binding sequence at -145 (ATTA) reduced reporter activity by half. Results of EMSAs showed that nuclear extracts from Ang II-treated SMCs exhibited enhanced binding activity of serum response factor (SRF) to the CArG elements and of a homeodomain factor, MHox, to the ATTA element. Northern analyses showed that Ang II also stimulated marked increases in MHox mRNA levels. Western analyses demonstrated that Ang II-induced increases in SRF binding were not due to increased SRF protein expression. Recombinant MHox markedly enhanced binding activity of SRF in EMSAs. Finally, MHox overexpression transactivated a SM alpha-actin promoter/CAT reporter construct by approximately 3.5-fold in transient cotransfection studies. These results provide evidence for involvement of a homeodomain transcription factor, MHox, in Ang II-mediated stimulation of SM alpha-actin via a CArG/SRF-dependent mechanism.
...
PMID:Angiotensin II-induced stimulation of smooth muscle alpha-actin expression by serum response factor and the homeodomain transcription factor MHox. 931 42


1

---