Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
 5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Mouse embryonal carcinoma (EC) cell lines were established which carry the stably integrated chloramphenicol acetyltransferase (CAT) gene under the control of the transcriptional elements of the long terminal repeat (LTR) of Moloney murine leukemia virus. The activity of three elements of the stably integrated LTR was analyzed in undifferentiated EC cells (stable CAT assay). Results of the study are summarized as follows. (i) In the stable assay, the promoter region of the LTR was inactive in undifferentiated ECA2 and F9 cells, and the level of the activity was 10(-4) of that in NIH 3T3 cells. (ii) In contrast to the results of the transient assay, the enhancer was active in undifferentiated ECA2 cells and in F9 cells. It activated CAT activity more than 60-fold and about 8-fold in ECA2 cells and F9 cells, respectively. (iii) Suppression by ELP, the embryonal LTR-binding protein, was more pronounced in the stable assay than in the transient assay. These data suggest that, when compared with NIH 3T3 cells, a major factor for the inactivity of the LTR in EC cells is the inefficiency of the promoter in this assay. Transcriptional activity of the LTR was analyzed during the differentiation of EC cells. In the case of ECA2 cells, the magnitude of activation by the enhancer did not change during differentiation. The activity of the promoter increased about 10-fold, and the suppression by ELP became negligible 4 days after the induction of differentiation. Upon differentiation of F9 cells, the activity of the enhancer increased more than 300-fold, but the promoter remained inactive. The pattern of LTR-binding proteins also varied during the differentiation of EC cells. Our present data suggest that the activity of LTR elements as assayed by the stable assay differs from the activity as assayed by the transient assay. It also indicates that the activity of these elements exhibits cell-type-specific changes during the differentiation of EC cells.
 ...
PMID:Analysis of the binding proteins and activity of the long terminal repeat of Moloney murine leukemia virus during differentiation of mouse embryonal carcinoma cells. 203 63

Sequence-specific DNA-binding proteins that bind to the long terminal repeat (LTR) of Moloney leukemia virus in undifferentiated and differentiated mouse embryonal carcinoma (EC) cells were identified by gel retardation assay. The proteins that bind to the CCAAT box were present in both undifferentiated and differentiated EC cells. The amounts and the number of species of the proteins that bind to the enhancer and the GC-rich region were far lower in undifferentiated EC cells than in the differentiated counterparts. These proteins were supposed to be transcriptional activators. Proteins that bind upstream of the enhancer, namely, the -352 to -346 region and the -407 to -404 region, were identified. These proteins were designated the embryonic LTR-binding protein (ELP) and the LTR-binding protein, respectively. The ELP was present only in undifferentiated EC cell lines. The LTR-binding protein was detected in all cell lines tested. The mechanism of suppression of the LTR was investigated by the chloramphenicol acetyltransferase assay. The enhancer and the GC-rich region of the LTR functioned poorly in undifferentiated cells. When eight copies of ELP-binding sequences were inserted upstream of the enhancer region, expression of the chloramphenicol acetyltransferase gene was reduced about threefold in ECA2 cells. From these data, we concluded that two mechanisms, the shortage of activator proteins and the presence of a negative regulatory protein (ELP), are involved in the suppression of the LTR in undifferentiated EC cells.
 ...
PMID:Mechanism of suppression of the long terminal repeat of Moloney leukemia virus in mouse embryonal carcinoma cells. 260 93

BOX DNA was previously isolated from the DNA sequence inserted in the enhancer B domain of mutant polyomavirus (fPyF9) DNA. We also reported that BOX DNA functioned negatively on DNA replication and transcription of another polyomavirus mutant (PyhrN2) in F9-28 cells, a subclone of mouse F9 embryonal carcinoma (EC) cells expressing the polyomavirus large T antigen. In this study, we demonstrate that BOX DNA enhances transcription from the thymidine kinase (TK) promoter in various EC cells. One or three copies of BOX DNA, linked to the bacterial chloramphenicol acetyltransferase gene under the control of the herpes simplex virus TK promoter, activated promoter activity in F9, P19, and ECA2 cells. Band shift assays using BOX DNA as a probe revealed that specific binding proteins were present in all EC cells examined; the patterns of BOX DNA-protein complexes were the same among them. A mutation introduced within BOX DNA abolished enhancer activity as well as the formation of specific DNA-protein complexes. In non-EC cells, including L and BALB/3T3 cells, the enhancer activity of BOX DNA on the TK promoter was not observed, although binding proteins specific to the sequence exist. In band shift assays, the patterns of the DNA-protein complexes of either L or BALB/3T3 cells were different from those of EC cells. Furthermore, the enhancer activity of BOX DNA decreased upon differentiation induction in all EC cells examined, of different origins and distinct differentiation ability. In parallel with the loss of enhancer activity, the binding proteins specific for BOX DNA decreased in these cells. Moreover, we cloned a genomic DNA of F9, termed BOXF1, containing BOX DNA sequence approximately 400 bp upstream from the RNA start site of the gene. BOXF1, containing a TATA-like motif and the binding elements for Sp1 and Oct in addition to BOX DNA, possessed promoter activity deduced by a BOXF1-chloramphenicol acetyltransferase construct. Deletion analyses of the construct revealed that the transcription of BOXF1 gene is regulated by BOX DNA, preferentially in undifferentiated EC cells versus differentiated cells. Hence, BOX DNA is probably a novel transcriptional element related to EC cell differentiation.
 ...
PMID:BOX DNA: a novel regulatory element related to embryonal carcinoma cell differentiation. 790 32

We have isolated and analyzed the structure of the gene grik5 (glutamate receptor ionotropic kainate 5), encoding the rat kainate receptor subunit KA2. Six overlapping DNA fragments containing the entire grik5 gene were identified in a rat genomic library. grik5 is a unique gene composed of 20 exons that together span over 54 kilobases (kb). Reporter gene analysis demonstrated that 2 kb of grik5 5'-flanking sequence confers tissue-specific expression on a chloramphenicol acetyltransferase gene in vitro. We show that (i) the first intron of grik5 (3.4 kb) inhibited transcription of the chloramphenicol acetyltransferase gene driven by the 2-kb grik5 5'-flanking region; (ii) the negative regulatory element was located within 500 bp of the 3'-end of intron 1, and this 500-bp fragment selectively bound nuclear proteins isolated from neural and nonneural cells; (iii) the effect of the negative regulatory element on grik5 transcription was orientation- and distance-independent; and (iv) a 24-nucleotide sequence (CTTTCTGTGGCCTCTGACCTTTCC) was identified as the binding site for nuclear proteins within the 500-bp fragment, as determined by footprinting and gel shift assays. We conclude that an intronic element that displays features of a silencer modulates grik5 transcription.
 ...
PMID:Gene structure of the rat kainate receptor subunit KA2 and characterization of an intronic negative regulatory region. 907 93