Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Skeletal alpha-actin mRNA increases in the adult heart during cardiac hypertrophy after the imposition of hemodynamic overload/aortic restriction. 3,3',5-Triiodo-L-thyronine (T3) elicits a cardiac response similar to the effect of prolonged exercise and was recently shown to cause a rapid increase in the amount of skeletal alpha-actin mRNA in hearts from normal and hypophysectomized animals. We used transient transfection analysis to show that T3 induces the expression of the native skeletal alpha-actin promoter between nucleotide positions -2000 and +239 linked to the chloramphenicol acetyltransferase reporter gene in COS-1 fibroblasts and myogenic C2C12 cells. This T3 (10-100 nM)-induced transcriptional activation is dependent on the expression of the thyroid hormone receptors from transfected alpha 1 and beta 1 c-erbA complementary DNA expression vectors. Electrophoretic mobility shift assays were used to identify a thyroid hormone response element (TRE) in the human skeletal alpha-actin gene. This TRE is located between nucleotide positions -173 and -149 with respect to the start of transcription at +1 (5' TGGTCAACGCAGGGGACCCGGGCGG 3'). Electrophoretic mobility shift assay experiments showed that the putative skeletal alpha-actin TRE and defined rodent growth hormone TREs (that bind thyroid hormone receptors in vitro and in vivo) interacted with an identical nuclear factor in vitro in muscle cells that was developmentally regulated during myogenesis. Transient transfection analysis utilizing 5' unidirectional deletions of the skeletal alpha-actin promoter indicated that cis-acting sequences between nucleotide positions -432 and -153, which encompassed the TRE, were required for T3/thyroid hormone receptor-dependent trans-activation in vivo. Furthermore, we demonstrated that the skeletal alpha-actin TRE is juxtaposed next to SRF and SpI binding sites, at its 5' and 3' flanks, respectively. It is also surrounded by sequences densely populated by other SpI, SRF, and CTF binding sites. In conclusion, these results indicate that T3-induced increases in alpha-actin mRNA in animals are mediated by a direct transcriptional mechanism that may involve interactions with ubiquitous proteins.
...
PMID:The human skeletal alpha-actin promoter is regulated by thyroid hormone: identification of a thyroid hormone response element. 131 69

The effects of thyroid hormone on expression of cardiac myosin heavy chain genes generally are thought to be mediated by nuclear 3,5,3'-triiodo-L-thyronine (T3) receptors that have been identified as the products of the protooncogene, c-erbA. This hypothesis has been tested by transfection of cardiomyocytes in primary culture with a plasmid, pRSVhEACAT-, expressing anti-sense c-erbA mRNA. Because only a low percentage of cells (20%) could be transfected in primary culture an alpha-myosin heavy chain-chloramphenicol acetyltransferase fusion construct was used as a reporter gene. The results indicate that the anti-sense plasmid almost completely blocks T3-induced activity of the reporter gene (less than 1% control) while transfection of a similar amount of the sense construct, pRSVhEACAT+, has no effect. When the c-erbA plasmids were cotransfected with constructs containing T3-independent promoters, no effects on expression were observed. The combined use of an anti-sense construct and a report gene provides a means of studying the role of c-erbA products in intracellular signal transduction even in differentiated, nondividing cells like those of the heart.
...
PMID:An anti-sense c-erbA clone inhibits thyroid hormone-induced expression from the alpha-myosin heavy chain promoter. 169 Jul 29

An important physiological control of the glycoprotein hormone alpha-subunit is the negative feedback by thyroid hormones in the thyrotrope. A region of the rat glycoprotein hormone alpha-subunit gene that is involved in transcriptional regulation by thyroid hormone has been identified by transient transfection studies, and sequence-specific binding of the thyroid hormone receptor to a site within this region has been demonstrated. Deletion-mutation studies using plasmid expression vectors containing either 246, 170, or 80 base pairs of the 5'-flanking region of the rat alpha-subunit gene fused to the coding region of the bacterial chloramphenicol acetyltransferase gene demonstrate 3,5,3'-triiodo-L-thyronine (T3)-regulated expression in GH3 cells, a T3-responsive somatotrophic cell line. In order to investigate the possibility of thyroid hormone receptor interaction with this segment of the rat alpha-subunit gene, the binding of the thyroid hormone receptor to synthetic oligodeoxynucleotides was analyzed using an avidin-biotin complex DNA binding assay. An oligodeoxyribonucleotide representing a fragment of the alpha-subunit gene from -74 to -38, relative to the transcriptional start site, shows significant binding to [125I]T3-receptor complex present in nuclear extracts of GH3 cells. This fragment binds receptor to a degree similar to that seen with a fragment of the rat growth hormone gene which contains a putative thyroid hormone-responsive element. In addition, this fragment of the rat alpha-subunit gene binds to the in vitro synthesized human c-erbA beta protein, which has been identified as a member of the family of putative T3 receptors. These data demonstrate that a cis-active thyroid hormone-responsive element resides in the 5'-flanking region of the rat alpha-subunit gene and that the mechanism involved in the suppression of expression of this gene by T3 could involve specific binding of the thyroid hormone receptor to this region of the gene.
...
PMID:Thyroid hormone regulation of the rat glycoprotein hormone alpha-subunit gene promoter activity. 246 63

The retinoic acid (RA)-associated differentiation of murine F9 teratocarcinoma stem cells results in dramatic changes in gene expression. The cellular gene encoding the B1 subunit of the extracellular matrix protein laminin is transcriptionally activated by RA, and its transcription is further enhanced by N6,O2'-dibutyryladenosine 3',5'-cyclic monophosphate (Bt2cAMP) during the differentiation of F9 stem cells into extraembryonic parietal endoderm cells. We now report that expression vectors encoding the human RA receptors RAR-alpha, RAR-beta, and RAR-gamma can activate chloramphenicol acetyltransferase (CAT) expression from laminin B1 promoter/CAT expression vectors (e.g., p1.6LAMCAT) in RA-treated F9 cells, as measured in a transient transfection assay. Bt2cAMP does not further enhance the RA-associated increase in CAT activity. Through the use of deletion and mutation analyses, the RA-responsive element (RARE) of the murine laminin B1 gene has been defined as a 46-base-pair element between -477 and -432 of the laminin B1 5' flanking region. Insertion of a region of DNA containing this RARE in either orientation into a thymidine kinase promoter/CAT expression vector causes CAT expression to be activated 5- to 9-fold by the cotransfected human RAR-alpha or RAR-beta constructs in RA-treated F9 cells, and this RARE also functions in human HeLa cells. In contrast, this RARE in the p1.6LAMCAT vector does not activate CAT expression when cotransfected into F9 stem cells with the c-erbA gene in the presence of thyroid hormone. This suggests that the laminin B1 gene is activated by RA but not by thyroid hormone in vivo.
...
PMID:A retinoic acid-responsive element is present in the 5' flanking region of the laminin B1 gene. 255 99

We are interested in the mechanisms by which endocrine and developmental factors regulate TSH synthesis at both pre-translational and post-translational levels. Thyroid hormone profoundly decreases transcription of the TSH-beta gene, while TRH and agents modifying cyclic AMP increase transcription. To elucidate the molecular mechanisms underlying these effects, human embryonal kidney cells were transfected with constructs of the human TSH-beta gene fused to the chloramphenicol acetyltransferase gene. The first exon of human TSH-beta, contains an element that increases basal expression and mediates T3-induced gene repression, probably through a direct interaction with c-erbA beta. This transcriptional repression by T3 appears aberrant in thyrotropic tumors. In contrast, TRH and agents modifying cyclic AMP mediate increased transcription of TSH-beta through interacting with upstream regulatory elements. Thyroid hormone, TRH and developmental factors also regulate the branching pattern and relative sialylation of TSH carbohydrate chains, which may affect TSH action in vitro and in vivo. Certain thyrotropic tumors produce TSH with more complex carbohydrate branching patterns, which may increase its biologic activity.
...
PMID:Pre-translational and post-translational regulation of TSH synthesis in normal and neoplastic thyrotrophs. 269 12

Thyroid hormone regulation of the human thyrotropin beta-subunit gene (TSH beta) was examined in a human embryonal cell line (293). Transient expression studies were performed with chimeric plasmids containing the reporter gene, chloramphenicol acetyltransferase. Sequences in the first exon between +9 and +37 base pairs (bp) enhanced gene expression from the human TSH beta promoter in the absence of thyroid hormone as well as mediated a concentration-dependent triiodothyronine (L-T3) decrease in gene expression. Thyroid hormone inhibition of expression was also conferred to the herpes simplex virus thymidine kinase promoter by inserting +3 to +37 bp of the human TSH beta gene downstream from the start of transcription. Primer extension analysis of RNA from transfected cell cultures revealed accurate transcription initiation in only those constructs which contained sequences between +9 and +37 bp. Moreover, RNA analysis confirmed that L-T3 inhibition of chloramphenicol acetyltransferase activity from chimeric pTSH beta CAT constructs occurred at a pretranslational level. In addition, a nuclear thyroid hormone receptor, c-erbA-beta, bound to this region in an avidin-biotin DNA binding assay. These data suggest that L-T3, bound to its receptor, may inhibit human TSH beta expression by interfering with an element that functions to enhance gene expression.
...
PMID:Thyroid hormone inhibition of human thyrotropin beta-subunit gene expression is mediated by a cis-acting element located in the first exon. 276 33

We have isolated a c-erbA cDNA clone from a GH3 cell library. The clone, denoted erb62, is 4.5 kilobases long and encodes a 461-amino acid beta-type c-erbA protein. This c-erbA protein binds 3,5,3'-triiodothyronine (T3) and T3 analogs with affinities similar to those of the authentic T3 receptor. By RNA gel blot analysis, erb62 hybridizes to a 6-kilobase RNA found in organs that express T3 receptors--e.g., heart, kidney, and brain. A COS-cell transient cotransfection system was used to show that erb62 encodes a biologically active T3 receptor. An oligonucleotide, corresponding to a portion of the rat growth hormone gene 5'-flanking region that contains a T3 response element, was inserted on the 5' side of the herpes simplex virus thymidine kinase promoter in a chloramphenicol acetyltransferase-expressing plasmid. Reporter gene expression directed by this hybrid promoter was T3 inducible only if this plasmid was cotransfected with an erb62-expressing plasmid.
...
PMID:Isolation of a cDNA clone encoding a biologically active thyroid hormone receptor. 289 22

We have extensively characterized the sequences of the rat growth hormone (rGH) promoter required for induction by T3 (thyroid hormone, 3,5,3'-L-triiodothyronine) in a transient transfection system. Oligonucleotides containing portions of the rGH promoter sequence with various deletions and point mutations were placed upstream of the first 137 base pairs of the rGH promoter or the heterologous herpes virus thymidine kinase promoter in chloramphenicol acetyltransferase expression vectors. The rGH137 and thymidine kinase promoters show no or minimal response to T3 in the basal state. The constructs were tested in GH4C1 rat pituitary cells and COS cells (functionally deficient in thyroid hormone receptor) with and without a co-transfected plasmid expressing a beta type c-erbA gene coding for a functional T3 receptor. Oligonucleotides containing the T3 receptor binding site confer hormone-dependent induction in a manner that is independent of either orientation or variation in position on the helix relative to the promoter. Point mutations in the sequence -189 to -173 result in loss of T3 induction, and bases between -173 and -167 were also required for a full T3 response. The minimal length to confer T3 induction to the rGH promoter was 23 base pairs (-190 to -167). Point mutations creating a perfect duplication of 7 base pairs within the receptor binding site conferred 12-fold T3 response to the rGH137 promoter, 3-fold greater than the wild type rGH237 construct. T3 inductibility was also transferred to the thymidine kinase promoter by an oligonucleotide containing the sequence -200 to -157, demonstrating that cell type specific elements located 3' to 157 of the rGH promoter are not required for thyroid hormone responsiveness.
...
PMID:Functional characterization of the rat growth hormone promoter elements required for induction by thyroid hormone with and without a co-transfected beta type thyroid hormone receptor. 290 14

The cDNA for a member of the nuclear receptor family was cloned and named ubiquitous receptor (UR), since UR protein and mRNA are detected in many cell types. Rat UR/human retinoid X receptor alpha (hRXR alpha) heterodimers bound preferentially to double-stranded oligonucleotide direct repeats having the consensus half-site sequence AGGTCA and 4-nt spacing (DR-4). Coexpression of UR in COS-1 cells inhibited the stimulation of chloramphenicol acetyltransferase (CAT) reporter gene expression by hRXR alpha and human retinoic acid receptor alpha in the presence of all-trans-retinoic acid when DR-4 (but not DR-5) was present upstream of the promoter of a CAT reporter gene (DR-4-CAT). UR expression also inhibited the activation of a DR-4-CAT reporter gene by hRXR alpha and 9-cis-retinoic acid or by thyroid hormone receptor beta in the presence of thyroid hormone. However, in the absence of 9-cis-retinoic acid, UR in combination with hRXR alpha stimulation DR-4-CAT expression. Coexpression of thyroid hormone receptor markedly reduced this stimulation in the absence of thyroid hormone. UR may play an important role in normal growth and differentiation by modulating gene activation in retinoic acid and thyroid hormone signaling pathways.
...
PMID:Ubiquitous receptor: a receptor that modulates gene activation by retinoic acid and thyroid hormone receptors. 797 66

Autoregulation of the human thyroid hormone receptor beta 1 (hTR beta 1) promoter was assessed by chloramphenicol acetyltransferase and luciferase reporter assays of transient transfections into COS1 and GH3 cells, DNase I footprinting, and gel shift assays. A 5'-deletional analysis of the promoter showed that the region between -906 and -839 and the sequence from -438 to -130 were positively regulated by T3 in COS1 cells cotransfected with an hTR beta 1 expression vector. We also transfected deletion constructs into GH3 cells and showed similar effects of T3 on the trans-activation of the reporters. DNase I footprinting showed a protected inverted palindromic thyroid response element (TRE) at position -890 to -866 in the distal fragment and a direct repeat at position -190 to -166 in the proximal fragment, which were protected by TRs. Mutation of each TRE significantly decreased the trans-activation of the promoter by T3. Gel mobility shift assays showed both proximal and distal TREs formed a retarded band with hTR alpha 1 or hTR beta 1 expressed in COS1 cells and reticulocyte lysates. The bands formed on the distal TRE and the proximal TRE appear to be preferentially formed by a TR homodimer and a heterodimer, respectively. Furthermore, the band formed on the distal TRE disappeared after adding T3 but that on the proximal TRE did not. These results indicate that hTR beta 1 expression is directly regulated by hTR alpha 1, beta 1, and their ligand through two TREs. The different structure of the TREs in this promoter suggests their physiological role in transcriptional regulation may be different.
...
PMID:Two thyroid hormone response elements are present in the promoter of human thyroid hormone receptor beta 1. 801 48


1 2 Next >>

---