Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Wild-type (w.t.) p53 acts as a transcriptional regulator that binds to DNA and modulates transcription of several promoters. Wild-type p53 has also been shown to autoregulate its own transcription. There is no agreement, however, on whether w.t. p53 has trans-activates or downregulates its own transcription. To further explore the transcriptional autoregulation of the p53 gene, we analyzed the effect of w.t. p53 on its own promoter in different cell lines that do not express p53. A DNA domain within the human p53 promoter (-48 to -23) with the structure of ATGGGATTGGGGTTTTCCCCTCCCAT shares 8 of 10 nucleotides sequence homology with the p53 binding motif. When the human p53 promoter that included this domain was linked to a chloramphenicol acetyltransferase (CAT) gene and coexpressed with w.t. or mutated p53 in cells lacking p53 protein, w.t. p53 down-regulated its own promoter in SAOS-2 and K562 cells, but not in DP15 cells. We were unable to detect direct interaction of p53 with its promoter or to domain -48 to -23 following transfection of these cells with w.t. p53. A different pattern of protein--DNA complexes was observed, however, between the p53 promoter and nuclear extracts from SAOS-2 and DP15 cells following transfection with w.t. p53. These data suggest that w.t. p53 autoregulates its own promoter indirectly and in a cell type-specific manner.
...
PMID:Wild-type p53 regulates its own transcription in a cell-type specific manner. 766 53

The possibility that appropriately designed chemotherapy could act selectively against p53-defective tumor cells was explored in MCF-7 human breast cancer cells. These cells were chosen because they have normal p53 function but are representative of a tumor cell type that does not readily undergo p53-dependent apoptosis. Two sublines (MCF-7/E6 and MCF-7/mu-p53) were established in which p53 function was disrupted by transfection with either the human papillomavirus type-16 E6 gene or a dominant-negative mutant p53 gene. p53 function in MCF-7/E6 and MCF-7/mu-p53 cells was defective relative to control cells in that there were no increases in p53 or p21Waf1/Cip1 protein levels and no G1 arrest following exposure to ionizing radiation. Survival assays showed that p53 disruption sensitized MCF-7 cells to cisplatin (CDDP) but not to several other DNA-damaging agents. CDDP sensitization was not limited to MCF-7 cells since p53 disruption in human colon carcinoma RKO cells also enhanced sensitivity to CDDP. Contrary to the other DNA-damaging agents tested, CDDP-induced DNA lesions are repaired extensively by nucleotide excision, and in agreement with a defect in this process, MCF-7/E6 and MCF-7/mu-p53 cells exhibited a reduced ability to repair a CDDP-damaged chloramphenicol acetyltransferase-reporter plasmid transfected into the cells. Therefore, we attributed the increased CDDP sensitivity of MCF-7 cells with disrupted p53 to defects in G1 checkpoint control, nucleotide excision repair, or both. The G2 checkpoint inhibitor pentoxifylline exhibited synergism with CDDP in killing MCF-7/E6 cells but did not affect sensitivity of the control cells. Moreover, pentoxifylline inhibited G2 checkpoint function to a greater extent in MCF-7/E6 than in the parental cells. These results suggested that, in the absence of p53 function, cancer cells are more vulnerable to G2 checkpoint abrogators. Our results show that a combination of CDDP and pentoxifylline is capable of synergistic and preferential killing of p53-defective tumor cells that do not readily undergo apoptosis.
...
PMID:Disruption of p53 function sensitizes breast cancer MCF-7 cells to cisplatin and pentoxifylline. 771 69

The effect of human wild type and mutant p53 proteins on the human multidrug resistance (MDR1) promoter was studied in a p53-negative human cell line. Transient expression of MDR1 promoter-chloramphenicol acetyltransferase reporter gene constructs (MDRCAT) cotransfected with p53 expression vectors was analyzed in H358 lung carcinoma cells. Cotransfection with a wild type p53 expression vector stimulated MDRCAT activity, while cotransfection with mutant p53 expression vectors altered at amino acid positions 181, 252, 258, or 273 failed to stimulate expression. Wild type p53 stimulation of MDRCAT activity was time dependent with maximal expression occurring 24-30 h following transfection and correlating with high p53 protein levels. MDR1 promoter deletion analysis suggested that the sequences involved in wild type p53 stimulation of MDRCAT activity were contained within the region from -39 to +53 relative to the start of transcription at +1. This region contains no TATA or p53 consensus binding sequence but does contain an initiator sequence. Wild type p53 stimulation of MDRCAT expression also occurred in parental and doxorubicin-resistant SW620 colon and parental 2780 ovarian cancer cell lines, indicating that wild type p53-mediated simulation of the MDR1 promoter is not restricted to a single cell line.
...
PMID:Wild type p53 stimulates expression from the human multidrug resistance promoter in a p53-negative cell line. 782 27

The bax gene promoter region contains four motifs with homology to consensus p53-binding sites. In cotransfection assays using p53-deficient tumor cell lines, wild-type but not mutant p53 expression plasmids transactivated a reporter gene plasmid that utilized the bax gene promoter to drive transcription of chloramphenicol acetyltransferase. In addition, wild-type p53 transactivated reporter gene constructs containing a heterologous minimal promoter and a 39-bp region from the bax gene promoter in which the p53-binding site consensus sequences reside. Introduction of mutations into the consensus p53-binding site sequences abolished p53 responsiveness of reporter gene plasmids. Wild-type but not mutant p53 protein bound to oligonucleotides corresponding to this region of the bax promoter, based on gel retardation assays. Taken together, the results suggest that bax is a p53 primary-response gene, presumably involved in a p53-regulated pathway for induction of apoptosis.
...
PMID:Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. 783 49

A plasmid carrying the 5' flanking region of the mouse proliferating-cell-nuclear-antigen (PCNA) gene or DNA polymerase beta gene was fused with the chloramphenicol acetyltransferase (CAT) gene, then cotransfected into mouse N18TG2 cells with the expression plasmid for the p53 gene. Expression of the wild-type p53 repressed the CAT expression directed by the PCNA gene promoter, while it had little effect on the DNA polymerase beta gene promoter. RNase protection analysis revealed that the repression of the PCNA gene promoter by p53 was at the transcription step. Analysis with various deletion mutants in the PCNA gene promoter revealed that a specific sequence is not required for the repression, suggesting that p53 represses the PCNA gene promoter by interacting with some components of the basic transcription machinery. By analysis with various deletion mutants in the DNA polymerase beta gene promoter, we identified the unique 10-bp palindromic sequence (-24 to -15), in the presence of which p53 was not able to repress the promoter activity. This sequence conferred resistance to p53 repression onto the PCNA gene promoter, when it was placed 21-bp upstream from the transcription-initiation site.
...
PMID:Differential effect of p53 on the promoters of mouse DNA polymerase beta gene and proliferating-cell-nuclear-antigen gene. 790 18

We have investigated the effect of Xenopus laevis p53 (Xp53) on transcription from a variety of promoters which are regulated by mouse p53 using a chloramphenicol acetyltransferase reporter system. Although Xp53 transactivated promoters that are up-regulated by mouse p53, it was unable to cause repression. This ability to transactivate gene expression was dependent on a temperature of 32 degrees C, and activity was lost at 37 degrees C. Temperature-sensitive transactivation was correlated with temperature-dependent binding of Xp53 to the adenovirus E1B58K protein. Despite the marked loss of transcriptional activation and binding to E1B58K at 37 degrees C, Xp53 was still capable of binding simian virus 40 large T antigen and inhibiting simian virus 40 origin-dependent DNA replication. These data show that Xp53 is temperature sensitive for N-terminal activities and suggest that the transactivation and repression "domains" of p53 are distinct.
...
PMID:Functional characterization of Xenopus laevis p53: evidence of temperature-sensitive transactivation but not of repression. 793

We isolated the p53 gene from Syrian hamster embryo cells by cosmid cloning procedures. The organization of the hamster p53 gene was similar to that of other mammalian p53 genes; it had 11 exons, a noncoding exon 1, and a long intron 1 (about 6.5 kb). The upstream p53 promoter was isolated, and the nucleotide sequence of a region encompassing 694 bp upstream from the exon/intron 1 boundary plus the first 6 nt of intron 1 was determined. This genomic region was highly homologous to those of mice and humans but contained a repetitive element not present in either species. Sequence comparisons with the murine and human promoters revealed the presence of similar transcription-factor binding motifs mapping within a 431-bp SacI-PstI fragment. Transient transfection assays of primary Syrian hamster embryo cells and neoplastic cell lines with recombinant constructs in which the SacI-PstI fragment was placed upstream of a bacterial chloramphenicol acetyltransferase (CAT) gene revealed the efficient expression of CAT activity. Primer extension analyses identified several putative transcription initiation sites within the p53 upstream promoter, the strongest of which was located 315 bp upstream from the exon/intron 1 junction and about 30 bp upstream from the region encompassing the regulatory motifs.
...
PMID:Cloning of the Syrian hamster p53 gene: structural and functional characterization of the upstream promoter region. 794 7

Wild-type p53 has been shown to inhibit transcription from several viral and cellular promoters without known p53-binding sites, while transactivating promoters with p53-binding sites. Using a series of N- and C-terminal p53 deletion mutants and wild-type p53, we have defined the domains on p53 responsible for its transcriptional functions. To test transcriptional activation by p53 we have used a promoter-chloramphenicol acetyltransferase (CAT) construct containing synthetic p53-binding sites. To check transcriptional inhibition by p53 we have used a human cytomegalovirus immediate-early promoter construct, CMV-CAT. Using transient transfection-transcription assays in Saos-2 cells, we determined that the p53 transcriptional activation and repression domains overlap at the N-terminus. This suggests the possibility that the same transcriptional machinery is involved in both functions. A C-terminal deletion up to amino acid 327 (del 393-327) eliminated repression of CMV-CAT, while preserving the transactivation function to a large extent. Using gluteraldehyde cross-linking experiments, we observed that the mutant del 393-327, which is transactivation-competent, but repression-defective, could not oligomerize. Thus, oligomerization of p53 is not required for transactivation, but may be essential for repression. Interestingly, transactivation by the oligomerization-defective mutant could be inhibited by cotransfection with a plasmid expressing the transforming mutant p53-175H.
...
PMID:Overlapping domains on the p53 protein regulate its transcriptional activation and repression functions. 815 95

Recently, we have shown that the p53 tumor suppressor gene product can inhibit expression of the bcl-2 gene. In this report, we explored the molecular basis for p53-mediated down-regulation of bcl-2 gene expression using a cotransfection approach involving p53 expression plasmids and chloramphenicol acetyltransferase (CAT) reporter gene constructs containing regions from the bcl-2 gene. When transfected into a p53-deficient human lung cancer cell line H358, reporter gene constructs containing only the promoter region of bcl-2 and upstream sequences were not suppressed by p53. Inclusion of bcl-2 gene sequences corresponding to the 5' untranslated region in bcl-2/CAT constructs, however, resulted in p53-dependent down-regulation. A 195-base pair segment from the bcl-2 gene 5' untranslated region was found to be capable of conferring p53-dependent repression on a heterologous expression plasmid containing CAT under the control of an SV40 immediate early-region promoter. This p53-negative response element functioned in an orientation-independent manner when placed either upstream or downstream of the SV40-CAT transcription unit. The results demonstrate the existence of a negative response element in the bcl-2 gene through which p53 may either directly or indirectly transcriptionally down-regulate expression of this gene involved in the regulation of programmed cell death.
...
PMID:Identification of a p53-dependent negative response element in the bcl-2 gene. 820 30

The p53 tumor suppressor gene product, a sequence-specific DNA-binding protein, has been shown to act as a transcriptional activator and repressor both in vitro and in vivo. Consistent with its role in regulating transcription are recent observations that the N-terminal acidic domain of p53 binds directly to the TATA box-binding protein subunit of the general transcription factor, TF IID. It is now demonstrated that wild-type p53 (wt-p53) inhibits human immunodeficiency virus type 1 (HIV-1) long terminal repeat (LTR)-directed chloramphenicol acetyltransferase activity in a cotransfection assay system. Importantly, this effect of wt-p53 on the HIV-1 LTR was also demonstrated by in vitro transcription assays. In addition, the Sp1 sites and the TATA box of the HIV-1 LTR are demonstrated to be the primary sites involved with p53-induced effects on this viral promoter. The upstream elements of the HIV-1 LTR, including the nuclear factor kappa B (NF-kappa B) binding sites, decrease the p53-induced inhibitory effects on viral transcription. In the presence of the HIV-1 TAR sequence and Tat protein, the HIV-1 LTR also becomes less sensitive to wt-p53-induced inhibition. By using a retroviral vector delivery system, mutant forms of p53 genes were expressed in two HIV-1 latently infected cell lines, ACH-2 and U1. In the ACH-2 cell line, which is now demonstrated to contain an endogenous mutant form of p53 (amino acid 248, Arg to Gln), additional mutant p53 proteins did not alter HIV-1 replication. In U1 cells, which completely lack endogenous p53, overexpression of mutant p53 led to an increase in HIV-1 replication. Thus, these data indicate a possible functional role for wt-p53 and mutant p53 proteins in the control of HIV-1 replication patterns and proviral latency.
...
PMID:The tumor suppressor protein p53 strongly alters human immunodeficiency virus type 1 replication. 820 5


<< Previous 1 2 3 4 5 6 7 Next >>

---