Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Skeletal alpha-actin mRNA increases in the adult heart during cardiac hypertrophy after the imposition of hemodynamic overload/aortic restriction. 3,3',5-Triiodo-L-thyronine (T3) elicits a cardiac response similar to the effect of prolonged exercise and was recently shown to cause a rapid increase in the amount of skeletal alpha-actin mRNA in hearts from normal and hypophysectomized animals. We used transient transfection analysis to show that T3 induces the expression of the native skeletal alpha-actin promoter between nucleotide positions -2000 and +239 linked to the chloramphenicol acetyltransferase reporter gene in COS-1 fibroblasts and myogenic C2C12 cells. This T3 (10-100 nM)-induced transcriptional activation is dependent on the expression of the thyroid hormone receptors from transfected alpha 1 and beta 1 c-erbA complementary DNA expression vectors. Electrophoretic mobility shift assays were used to identify a thyroid hormone response element (TRE) in the human skeletal alpha-actin gene. This TRE is located between nucleotide positions -173 and -149 with respect to the start of transcription at +1 (5' TGGTCAACGCAGGGGACCCGGGCGG 3'). Electrophoretic mobility shift assay experiments showed that the putative skeletal alpha-actin TRE and defined rodent growth hormone TREs (that bind thyroid hormone receptors in vitro and in vivo) interacted with an identical nuclear factor in vitro in muscle cells that was developmentally regulated during myogenesis. Transient transfection analysis utilizing 5' unidirectional deletions of the skeletal alpha-actin promoter indicated that cis-acting sequences between nucleotide positions -432 and -153, which encompassed the TRE, were required for T3/thyroid hormone receptor-dependent trans-activation in vivo. Furthermore, we demonstrated that the skeletal alpha-actin TRE is juxtaposed next to SRF and SpI binding sites, at its 5' and 3' flanks, respectively. It is also surrounded by sequences densely populated by other SpI, SRF, and CTF binding sites. In conclusion, these results indicate that T3-induced increases in alpha-actin mRNA in animals are mediated by a direct transcriptional mechanism that may involve interactions with ubiquitous proteins.
...
PMID:The human skeletal alpha-actin promoter is regulated by thyroid hormone: identification of a thyroid hormone response element. 131 69

Activators of protein kinase C, such as 12-O-tetradecanoylphorbol 13-acetate (TPA), are known to regulate the expression of many genes, including the tumor necrosis factor alpha (TNF) gene, by affecting the level or activity of upstream transcription factors. To investigate the mechanism whereby TPA activates the TNF promoter, a series of 5'-deletion mutants of the human TNF promoter linked to chloramphenicol acetyltransferase was transfected into U937 human promonocytic cells. TPA produced a 7- to 11-fold activation of all TNF promoters tested, even those promoters truncated to contain only the core promoter with no upstream enhancer elements. The proximal TNF promoter containing only 28 nucleotides upstream and 10 nucleotides downstream of the RNA start site confers TPA activation to a variety of unrelated upstream enhancer elements and transcription factors, including Sp1, CTF/NF1, cyclic AMP-response element, GAL-E1a, and GAL-VP16. The level of activation by TPA depends on the TATA box structure, since the TPA response is greater in promoters containing the sequence TATAAA than in those containing TATTAA or TATTTA. These findings suggest that the core promoter region is a target for gene regulation by second-messenger pathways.
...
PMID:The core promoter region of the tumor necrosis factor alpha gene confers phorbol ester responsiveness to upstream transcriptional activators. 154 16

Plasminogen activator inhibitor-1 (PAI-1) is a serine protease inhibitor that inhibits both tissue-type and urokinase-type plasminogen activators. Expression of PAI-1 is regulated by growth factors, cytokines, and hormones. To determine the molecular mechanisms involved in the basal expression of the rat PAI-1 gene, we have analyzed the cis-acting sequences and the trans-acting factors involved in the transcription of this gene in the HTC rat hepatoma cell line. DNase I protection analyses revealed eight regions within the first 764 base pairs of 5'-flanking sequence that interact specifically with HTC cell nuclear proteins. The proteins that bind to five of the eight footprinted sites were identified as PEA3-, Sp1-, and CTF/NF-1-like proteins using competition electrophoretic mobility shift assays. The expression of fusion genes containing progressive 5' deletions of the rat PAI-1 promoter linked to the chloramphenicol acetyltransferase reporter gene were analyzed in transient transfection experiments in HTC cells. These studies demonstrated the Sp1 and CTF/NF-1 sites to be important for transcriptional activation. Two of the footprinted sites contain the sequence 5'-TTTGn(n)TCAAT-3' and were shown in competition electrophoretic mobility shift assays to bind the same or related protein(s). Sequences containing these sites, from -764 to -628 base pairs, and from -266 to -188 base pairs, were identified in functional studies as repressor elements of transcription.
...
PMID:Regulatory sequences and protein-binding sites involved in the expression of the rat plasminogen activator inhibitor-1 gene. 160 87

The mechanism of regulatory expression of human cytochrome P-450scc gene by cAMP was investigated in a transient expression system using Y-1 cells (mouse adrenal tumor cell line) and a chimeric DNA composed of the structural gene for bacterial chloramphenicol acetyltransferase and the 5' flanking upstream sequence of the cytochrome P-450scc (cholesterol desmolase) gene which was revealed to contain a DNA element(s) responsive to cAMP [Inoue, H. et al. (1988) Eur. J. Biochem. 171, 435-440]. Introduction of deletions and point mutations in the upstream regulatory sequence demonstrated that three regions were mainly required for response to cAMP. These regions contained a short similar sequence. All of them have a 5-bp motif GTCAT (or ATGAC) in common, and have at least two motifs which conserve four out of five base pairs of the consensus sequence of the cAMP-responsive element (CRE), CGTCA (or TGACG). They are all apparently necessary for regulation by cAMP. Gel mobility shift assays suggested that a binding factor(s) to these regions was present in the nuclear extracts of Y-1 cells and adrenal cortex tissues and appeared to be different from the somatostatin CRE-binding protein. Deletion analysis also suggested that the region around -44 was essential to the basal transcriptional activity. This region shows some similarity to the CTF NF-1 binding site [Johnson and McKnight (1989) Annu. Rev. Biochem. 58, 799-839].
...
PMID:Structures of regulatory regions in the human cytochrome P-450scc (desmolase) gene. 184 89

The transcriptional enhancer sequences of the papillomaviruses are regulated by trans-acting factors encoded by the viral E2 open reading frame. We have performed detailed functional and physical analyses of the enhancer of the human papillomavirus type 11 (HPV-11). Using the chloramphenicol acetyltransferase (CAT) assay in transiently transfected monkey CV-1 cells, the enhancer region has been localized to a 270-bp tract immediately preceding the E6 open reading frame, and it consists of two functional components. The first is a constitutive enhancer containing sequences homologous to the GT-, Sph-, and P-motifs found in the SV40 and polyomavirus enhancers; others resemble the recognition sequence for CTF (NF-1), a factor which stimulates transcription of certain eukaryotic genes and replication of adenovirus DNA. The second component is an inducible enhancer with a consensus sequence ACCN6GGT responsive to the E2 protein encoded by papillomaviruses. Tandem copies of portions of the constitutive enhancer function as an E2-independent enhancer, whereas multiple copies of HPV-11 DNA restriction fragments or synthetic oligonucleotides containing the E2-responsive sequence (E2-RS) act as an enhancer in the presence of the E2 protein encoded by HPV-1, HPV-11, or bovine papillomavirus type 1 (BPV-1). The inducible activity is lost when mutations are introduced into the E2-RS or when a mutant palindromic sequence is substituted. We have also expressed the E2 proteins of HPV-1, HPV-11, and BPV-1 in Escherichia coli and studied their physical interactions with the E2-responsive sequence in vitro. Filter-binding analyses with crude Escherichia coli lysates show that the E2 proteins bind to the E2-RS, but not to mutated motifs, with an affinity proportional to the copy number. These E2 proteins have been purified to near-homogeneity by sequence-specific DNA affinity chromatography using the synthetic E2-RS as a ligand. The purified proteins protect a DNA segment containing the E2-RS and several flanking nucleotides in pancreatic DNase I footprinting analyses. Based on these results, we conclude that E2 proteins activate the enhancer by binding directly to the E2-RS and interacting with other transcriptional factors and that the sequence ACCN6GGT is both necessary and sufficient for the E2 protein binding in vitro and for activation of RNA transcription in vivo.
...
PMID:Functional mapping of the human papillomavirus type 11 transcriptional enhancer and its interaction with the trans-acting E2 proteins. 283 26

The adenovirus early region 3 (E3) promoter is an early viral promoter which is strongly induced by the adenovirus transactivator protein E1A. DNase I footprinting with HeLa cell extracts has identified four factor-binding domains which appear to be involved in basal and E1A-induced transcriptional regulation. These binding domains may bind TATA region-binding factors (site I), the CREB/ATF protein (site II), the AP-1 protein (site III), and nuclear factor I/CTF (site IV). Recently, it has been shown that the DNA-binding domain of transcription factor AP-1 has homology with the yeast transcription factor GCN4 and that the yeast transactivator protein GAL4 is able to stimulate transcription in HeLa cells from promoters containing GAL4-binding sites. These results suggest an evolutionary conservation of both transcription factors and the mechanisms responsible for transcriptional activation in Saccharomyces cerevisiae and higher eucaryotic organisms. To determine whether similar patterns of transcriptional regulation were seen with the E3 promoter in HeLa and yeast cells, the E3 promoter fused to the chloramphenicol acetyltransferase (cat) gene was cloned into a high-copy-number plasmid and stably introduced into yeast cells. S1 analysis revealed that similar E3 promoter mRNA start sites were found in yeast and HeLa cells. DNase I footprinting with partially purified yeast extracts revealed that four regions of the E3 promoter were protected. Several of these regions were similar to binding sites determined by using HeLa cell extracts. Oligonucleotide mutagenesis of these binding domains indicated their importance in the transcriptional regulation of the E3 promoter in yeast cells. These results suggest that similar cellular transcription factor-binding sites may be involved in the regulation of promoters in both yeast and mammalian cells.
...
PMID:Adenovirus transcriptional regulatory regions are conserved in mammalian cells and Saccharomyces cerevisiae. 297 53

The involvement of c-myc in the genesis of animal neoplasia is now well documented for several systems. In order to define the precise role played by the myc gene in tumorigenesis, a better understanding of the normal regulation of myc expression is necessary. We have begun a study of the cis-acting regulatory sequences within the 5' flanking domain of the human c-myc gene. Regions important for myc promoter function have been identified by linkage to the coding sequences of the bacterial chloramphenicol acetyltransferase (cat) gene. Promoter deletion studies and in vivo competition assays for c-myc/cat recombinant plasmids have allowed the identification of a proximal 'core' promoter region capable of directing high levels of CAT activity. Further upstream a negative regulatory element (NRE2) has been identified which is capable of repressing cat gene expression and which functions by interaction with a transacting factor(s). Preliminary data suggests detection of NRE2 is dependent on both the type and amount of carrier DNA used in transient CAT assays. Initial experiments further indicate the involvement of at least two other distal regulatory domains, a negative regulatory domain (NRE1) and a putative enhancer-type region (E). In vitro footprint analysis has allowed the identification of DNA binding proteins which interact with NRE2 and the 'core' promoter. NRE2 contains binding sites for transcription factors Sp1 and CTF. The 'core' promoter domain appears to be highly complex and possesses several Sp1 binding sites.
...
PMID:Transcriptional regulation of the human c-myc gene. 307 67

12(R)-Hydroxy-5,8,14(Z,Z,Z)-eicosatrienoic acid (12(R)-HETrE) is an arachidonic acid metabolite formed by the corneal epithelium of several species, porcine leukocytes, and human and rat epidermal cells. It is a potent, stereospecific proinflammatory and angiogenic factor and its synthesis is increased manyfold in inflamed tissues, e.g. cornea and skin. It is possible that the angiogenic activity of 12(R)-HETrE is due to a direct mitogenic effect on microvessel endothelial cells via yet to be elucidated cellular and molecular mechanisms. In the present study, we demonstrated the ability of 12(R)-HETrE to stimulate the growth of quiescent endothelial cells in a time- and concentration-dependent manner with a maximal effect at 0.1 nM. This effect was highly stereospecific since its enantiomer, 12(S)-HETrE, had no effect within the same concentration range. Northern blot analysis and transient transfection experiments with chloramphenicol acetyltransferase constructs of oncogene promoter regions demonstrated significant increases over control (0.5% fetal calf serum) in c-myc-, c-jun, and c-fos mRNA levels and expression in cells treated with 0.1 nM 12(R)-HETrE. Electrophoretic mobility shift assay of nuclear protein extracts from cells treated with 12(R)-HETrE with specific radiolabeled oligonucleotides corresponding to known transcriptional binding sites, including AP-1, AP-2, SP1, TRE, NF kappa B, TFIID, OKT1, CREB, CTF/NF1, and GRE demonstrated a markedly rapid and specific increase in the binding activity of NF kappa B and to a lesser extent, AP-1. No significant increase was observed in the binding of other transcription factors assayed as compared to control (untreated) cells. Since the protooncogenes (c-fos, c-jun, and c-myc) are immediate early response genes that are implicated in the process of cell proliferation and differentiation, and activation of certain transcription factors, in particular NF kappa B, is associated with the immediate response of the cell to an injury, we propose that 12(R)HETrE's mitogenic and angiogenic activities are mediated, in part, via the activation of NF kappa B and expression of these protooncogenes.
...
PMID:Activation of nuclear factor kappa B and oncogene expression by 12(R)-hydroxyeicosatrienoic acid, an angiogenic factor in microvessel endothelial cells. 752 72

Circulating and tissue-specific monocytes/macrophages, through production of hydrolytic enzymes and growth factors, can dramatically affect the local tissue environment. Colony-stimulating factor-1 (CSF-1) is a key regulator of monocyte/macrophage cell activity. CSF-1 is produced by stromal elements, including fibroblasts, which are found in all tissues. To understand at the molecular level how changes in CSF-1 gene transcription are initiated in fibroblasts, we set out to identify the cis-acting elements and cognate trans-acting factor(s) that bind regulatory regions of the mouse CSF-1 gene. Analysis of heterologous reporter constructs containing the mouse CSF-1 promoter linked to the bacterial chloramphenicol acetyltransferase (CAT) gene in transiently transfected fibroblasts identified a cis-acting element located between base pairs -88 and -43 of the CSF-1 gene. Electrophoretic mobility-shift assays (EMSAs) and DNase I protection assays with nuclear extracts isolated from proliferating fibroblasts revealed distinct protein binding to the region spanning base pairs -90 to -68. Results from methylation interference assays suggest CTF/NF1 or a CTF/NF1-like factor is the cognate trans-acting factor. Mutation of the putative CTF/NF1 binding site in the CSF-1 promoter lead to a modest decrease in promoter activity in transiently transfected fibroblasts and monocytes. Therefore, we have demonstrated that CTF/NF1 or a CTF/NF1-like protein binds to the CSF-1 gene promoter; however, binding of the CTF/NF1-like protein alone does not significantly effect changes in CSF-1 gene promoter activity.
...
PMID:Binding of a CTF/NF1-like protein to the mouse colony-stimulating factor-1 gene promoter. 757 83

Transcriptional regulation of the interleukin-5 (IL-5) gene in T lymphocytes appears to be of central importance in the control of the eosinophilia characteristic of allergic responses and certain parasite infections. Previous studies of IL-5 gene regulation have been hampered by the lack of a transfection assay, which detects the antigen-responsive enhancer in the IL-5 promoter. Here we show that stable transfection of the Th2 clone D10.G4.1 and the T lymphoma EL4.23 with chloramphenicol acetyltransferase reporter gene constructs carrying the region to -3859 gives inducible expression with the known regulatory characteristics of the endogenous IL-5 gene. To facilitate detailed analysis of the promoter region, 3.9 kb of DNA sequence immediately up stream of the start of transcription was determined and the minimum upstream region required for inducible expression was further localized, by stable transfection studies in EL4.23 cells, to the region up to -1016. A CTF/NF1 site in the upstream enhancer at -940 to -928 was shown to be required for regulated inducible expression. Mutation of this sequence motif abolished inducibility and also prevented binding of the sequence to a nuclear protein(s). A TCATTT-containing element in the proximal promoter region was also demonstrated to be essential for inducible expression of the IL-5 gene, similar to the role of this conserved element in the transcriptional regulation of the granulocyte-macrophage colony-stimulating factor (GM-CSF) and IL-4 genes.
...
PMID:Localization of the inducible enhancer in the mouse interleukin-5 gene that is responsive to T-cell receptor stimulation. 771 77


1 2 Next >>

---