Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
 5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Regulation of human thyrotropin beta subunit gene (TSHB) expression by thyrotropin-releasing hormone (TRH) was examined in a clonal rat pituitary-cell line (GH3). Transient expression studies were done with various 5'-flanking DNA sequences of TSHB coupled to reporter gene chloramphenicol acetyltransferase. Deletion analysis defined two discrete regions (-128 to -92 base pairs and -28 to +8 base pairs) that each mediated an approximately 2-fold TRH induction. The upstream site contains a DNA sequence with close homology to the DNA-binding site for a pituitary-specific transcriptional factor Pit-1/GHF-1. DNase I footprinting analysis of mouse thyrotropic tumor extract as well as DNA-transfection studies using an expression vector containing an N-terminal deletion of Pit-1/GHF-1 cDNA suggest that Pit-1/GHF-1 or a closely related protein in the thyrotroph mediates TRH responsiveness of this gene. In addition, the downstream site overlaps with the recently characterized thyroid hormone-inhibitory element of TSHB. In fact, deletion of DNA sequences important in thyroid hormone-receptor binding (c-erbAB/c-ERBA2) from +3 to +8 base pairs, significantly reduced (30%) TRH responsiveness. The location of a TRH-stimulatory element near a thyroid hormone-inhibitory element may allow for fine control of TSHB expression in vivo.
 ...
PMID:Thyrotropin-releasing hormone regulation of human TSHB expression: role of a pituitary-specific transcription factor (Pit-1/GHF-1) and potential interaction with a thyroid hormone-inhibitory element. 190 56

We have isolated and restriction enzyme-mapped a human genomic DNA clone encompassing the first two exons and the 5' flanking sequence of the human intercellular adhesion molecule-1 (ICAM-1) gene. The transcription initiation site was identified using primer extension analysis, and 1.7 kb of DNA upstream of the transcription initiation site was sequenced. The 5' region and first exon of the ICAM-1 gene was found to be a CpG island as it was (i) (G + C)-rich with a high frequency of the dinucleotide CpG and (ii) hypomethylated irrespective of the level of ICAM-1 expression in the tissues examined. These features of the ICAM-1 promoter are similar to the promoters of many 'housekeeping' genes. However, consensus sequences for several potential regulatory elements were found in the 5'-flanking sequence, an observation in keeping with the pattern of strongly regulated ICAM-1 expression. Examination of the chromatin structure upstream of the ICAM-1 gene revealed the presence of a constitutive DNase I-hypersensitive site 1.5 kb upstream of the transcription initiation site. Direct evidence that the upstream region constitutes a promoter element was demonstrated in transient transfection assays. A series of chloramphenicol acetyltransferase gene (CAT) constructs containing 5' fragments ranging in size from 1054 to 310 bp had equivalent levels of promoter activity when transfected into HeLa cells. Using a CAT construct containing a 447 bp ICAM-1 promoter fragment, we demonstrate an increase in transcription in response to interferon gamma (IFN-gamma), suggesting that this proximal region of the promoter is responsible, at least in part, for IFN-gamma induction of ICAM-1 expression.
 ...
PMID:Isolation and characterization of the promoter region of the human intercellular adhesion molecule-1 gene. 190 68

The apolipoprotein A-II (apoA-II) gene regulatory region -911 to +29 strongly promotes the transcription of the promotorless chloramphenicol acetyltransferase (CAT) gene in cells of hepatic (HepG2) and intestinal (CaCo2) origin but not in HeLa cells. Deletion of nucleotides -911 to -860 decreased the hepatic and intestinal transcription to 7% and 18% of control, respectively. Further progressive deletions extending to nucleotides -614, -440, -230, and -80 abolished both hepatic and intestinal transcription, indicating that the distal promoter region -911 to -614 contains regulatory elements that are essential for intestinal and hepatic transcription. An internal deletion of the -614 to -230 region decreased hepatic transcription 60% while it increased intestinal transcription 140% of control indicating that the elements which control hepatic and intestinal transcription of the apoA-II gene may be different within this regulatory region. DNase I footprinting analysis with rat liver nuclear extracts identified 14 protected regions: A, -40 to -33; B, -65 to -42; C, -126 to -110; D, -276 to -255; E, -377 to -364; F, -404 to -384; G, -468 to -455; H, -573 to -554; I, -706 to -680; J, -734 to -716; K, -760 to -743; L, -803 to -773; M, -853 to -829, and N, -903 to -879, as the DNA binding sites for nuclear factors. Five of the regions (B, C, G, H, and K) bind to heat-stable factors. DNA binding gel electrophoretic assays indicated that region N (-903 to -879), which is essential for efficient transcription, binds predominantly a nuclear activity designated AIIN3. This activity is present in cells of hepatic and intestinal origin but absent in HeLa cells. Similar analysis showed that region H (-573 to -554) binds to the liver-specific factor HNF1/LFB1. Deletion of this region decreased hepatic and intestinal transcription 80 and 64% of control, respectively, suggesting that HNF1/LFB1 or a related activity contributes to optimal transcription but is not essential for the tissue-specific expression of the human apoA-II gene.
 ...
PMID:Promoter elements and factors required for hepatic transcription of the human ApoA-II gene. 190 68

The gfa gene encodes glial fibrillary acidic protein, an intermediate filament protein found almost exclusively in astrocytes. Transient transfection studies with a chloramphenicol acetyltransferase reporter gene were used to identify regions of the gfa gene responsible for its expression. Three regions, A, B, and D, were found to be important. The D region is located near the basal promoter, while A and B are next to each other about 1500 bp further upstream. The regions contain several sequences homologous to binding sites of known transcription factors, and in addition, each contains an identical novel 10-bp motif. The A, B, and D regions act in a cell-specific manner; when joined to the SV 40 early promoter, they enhance transcription in the glial cell line U251, but not in the nonglial cell line HepG2. Consistent with this observation, the DNase I footprint produced in these regions by nuclear extract from U251 cells differs from that produced by an extract from HepG2 cells. The B region appears to be the most active of the three, as by itself it stimulates strong cell-specific transcription, whereas addition of the other two regions has little effect. When the B region is at its normal distance from the basal promoter, deletion of D severely reduces transcription, but when B is placed near the promoter, D is unimportant. This suggests that the D region may function primarily to promote interactions that bring B close to the promoter.
 ...
PMID:Multiple interacting sites regulate astrocyte-specific transcription of the human gene for glial fibrillary acidic protein. 191 4

The endothelin peptides constitute a family of potent vasoconstrictor molecules. Endothelin-1 (ET1) is secreted by vascular endothelial cells and may have a role in the regulation of vascular tone. To better understand the function of ET1, we have investigated the transcriptional regulation of the ET1 gene. Utilizing reporter gene transfection experiments, we have previously identified two promoter regions, located at base pairs -148 to -117 (Region A) and -117 to -98 (Region B) of the ET1 gene. Both regions are necessary for high level ET1 transcription in endothelial cells. A nuclear protein binding to the GATA motif in Region A has been identified and proven to be necessary for expression of the ET1 gene. However, the cis-acting sequences and their cognate binding proteins for Region B have not been investigated. To identify protein binding motifs in Region B we performed DNase I footprinting and gel mobility shift assays using a DNA fragment encoding base pairs -204 to -94 of the ET1 gene. Results from these studies indicated that the AP1 consensus sequence (GTGACTAA) in Region B as the only protein-binding motif. Site-directed mutagenesis of the ET1 AP1 site resulted in a 30-fold reduction in promoter activity, establishing the functional significance of this sequence. Additional experiments investigated the role of Jun and Fos in ET1 transcription. By employing antisera to Jun and Fos in gel mobility shift assays, both of these proteins were identified as endothelial cell nuclear proteins binding to the ET1 AP1 sequence. In trans-activation experiments, we showed that cotransfection of c-fos and c-jun expression plasmids markedly increased the transcription rate of chloramphenicol acetyltransferase reporter plasmids containing three synthetic ET1 AP1 sites. Taken together, these data indicate the importance of the AP1 recognition sequence, and the role of Fos and Jun proteins in the regulation of ET1 gene transcription.
 ...
PMID:Regulation of endothelin-1 gene expression by Fos and Jun. 191 21

Mouse lactoferrin is expressed in a variety of tissues under different types of control. To understand how molecular mechanisms govern the mode of lactoferrin expression, we isolated and characterized the 5'-flanking region of the lactoferrin gene. Several clones containing lactoferrin gene fragments were isolated from a mouse (129/J) genomic library including clone lambda J14, which contains a 7.5-kilobase pair 5'-flanking sequence. Sequence analysis of the region flanking the transcription initiation site revealed the following: a TATA-like sequence, two CAAT boxes, three GC boxes including one within the first intron, an AP2 site, seven PU boxes, an AC-rich region, a B1 sequence, and an estrogen-responsive element consensus sequence over-lapping with a chicken ovalbumin upstream promoter-binding element. Footprinting analysis demonstrated that several regions, including the putative estrogen-responsive element region, in the 5'-flanking sequence were protected from DNase I digestion. Promoter fragments were cloned into a chloramphenicol acetyltransferase receptor plasmid to study functional activity. The mouse lactoferrin gene promoter was active in human endometrium carcinoma RL 95-2 cells and in rat glioma C6 cells. Multiple upstream elements modulated the basal transcriptional promoter activity. The transcription level directed by this minimal promoter was controlled by both positive (between -1739 and -922) and negative (between -2644 and -1739, and between -589 and -291) regulatory sequences. A tissue-specific regulatory sequence was critical for the establishment of lactoferrin expression in human endometrium carcinoma cells, but not in rat glioma cells located between -1739 and -922. Reporter plasmid 0.6 mL14-CAT, containing the estrogen-responsive element sequence, was estrogen-responsive in the presence of estrogen receptor in human endometrium carcinoma RL 95-2 cells.
 ...
PMID:Characterization of estrogen-responsive mouse lactoferrin promoter. 193 12

This study is an attempt to determine whether estrogen could directly regulate human gonadotropin-releasing hormone (GnRH) gene expression. Human GnRH expression vectors were constructed by fusing various 5' flanking regions of the human GnRH gene upstream of the luciferase reporter gene (LUC) or the thymidine kinase promoter linked to the chloramphenicol acetyltransferase reporter gene (CAT). These constructs were transiently transfected into a human choriocarcinoma cell line (JEG-3) and LUC or CAT activity was measured after either no treatment or treatment with various concentrations of estradiol. A stimulatory estrogen response element (ERE) was localized to a 32-bp region between -547 and -516 bp. To determine whether estrogen receptor bound to this region of the gene, we performed DNase I footprinting using purified calf uterine estrogen receptor. DNase I footprinting demonstrates a strong footprint between -567 and -514 bp of the human GnRH gene. In addition, an avidin-biotin complex DNA-binding assay demonstrated that a biotinylated DNA fragment containing -541 to -517 bp of the human GnRH gene bound 35S-labeled estrogen receptor as well as a biotinylated DNA fragment containing the xenopus vitellogenin ERE. On the other hand, the negative control biotinylated DNA fragment derived from adenovirus 5 bound insignificant amounts of 35S-labeled estrogen receptor. Both the GnRH ERE and vitellogenin ERE bound 35S-labeled estrogen receptor with high affinity (approximately 1 nM). These data indicate that the human GnRH gene contains an ERE sufficient to mediate a stimulatory response to estrogen in heterologous cells. Based upon these data we hypothesize that the human GnRH gene might also be directly regulated by estrogen in the hypothalamus, and that this regulation may explain the GnRH hypersecretion observed at the time of the preovulatory luteinizing hormone (LH) surge.
 ...
PMID:Evidence for direct estrogen regulation of the human gonadotropin-releasing hormone gene. 193 51

In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11 beta) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11 beta-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at -331 bp to -324 bp in the promoter region of the P-450(11 beta) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11 beta) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11 beta) gene, and named them Ad5 and Ad6.(ABSTRACT TRUNCATED AT 250 WORDS)
 ...
PMID:Novel cAMP regulatory elements in the promoter region of bovine P-450(11 beta) gene. 196 88

The ugp operon of Escherichia coli includes genes involved in the uptake of sn-glycerol-3-phosphate and glycerophosphoryl diesters and belongs to the pho regulon which is induced by phosphate limitation. This operon has two transcriptional initiation sites, as determined by S1 nuclease mapping of the in vivo transcripts. The downstream promoter has multiple copies of the pho box, the consensus sequence shared by the pho promoters; the upstream promoter has a consensus sequence for the promoters regulated by cyclic AMP and its receptor protein, CRP. PhoB protein, which is the transcriptional activator for the pho regulon, protected the regulatory region with the pho boxes in DNase I footprinting experiments and activated transcription from the downstream promoter in vitro. Studies with transcriptional fusions between ugp and a promoterless gene for chloramphenicol acetyltransferase show that the upstream promoter is induced by carbon starvation in a manner that required the cya and crp genes. PhoB protein may act as a repressor for this upstream promoter, which also overlaps the upstream third pho box. The downstream promoter was induced by phosphate starvation and requires the PhoB protein for its activation as do the other pho regulon promoters. These results suggest that the two promoters function alternately in responding to phosphate or carbon starvation, thus providing the cell with a means to adapt to these physiological stresses.
 ...
PMID:Dual regulation of the ugp operon by phosphate and carbon starvation at two interspaced promoters. 198 50

To study the promoter of the chicken progesterone receptor (cPR) gene and the relevance of several progestin-responsive elements therein, chimeric genes were constructed which contained the 5'-flanking region of the cPR gene linked to promoterless globin or chloramphenicol acetyltransferase sequences. Cell-specific initiation of transcription was observed in transiently transfected chicken embryo fibroblasts when using 876 base pairs of the cPR gene upstream region. Transcription from these reporter genes could be induced by progestins in the presence of cPR form A but not of form B. In keeping with these data, three in vitro progesterone receptor (PR)-binding sites were identified in the cPR promoter region by DNase I protection assays. However, in vivo, nuclear run-on transcription demonstrated that neither primary stimulation with progestins, nor treatment of secondarily estrogen-stimulated chicks with progestins, glucocorticoids, or androgens resulted in any significant change of cPR gene transcription in the oviduct, thus suggesting a cell- and/or development-specific role for these progestin-responsive elements. Although estrogen is known to increase PR levels in the chick oviduct, this effect does not involve stimulation of PR gene transcription, as demonstrated here by nuclear run-on experiments, the analysis of DNase I hypersensitive sites, and transient cotransfection studies. Since acute withdrawal from estrogen-stimulation markedly decreased the level of cPR mRNAs in chick oviduct when analyzed by Northern blotting, we conclude that estrogen-dependent stimulation of PR levels in the oviduct is a post-transcriptional process.
 ...
PMID:Control of transcription of the chicken progesterone receptor gene. In vitro and in vivo studies. 199 8


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>