Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Adipocyte amino acid transporter (AAAT) is induced during the 3T3-L1 preadipocyte differentiation process. In the -1819-bp 5'-upstream flanking region of the AAAT genomic gene, six DNase I protected sites were identified by using the 3T3-L1 adipocyte nuclear extract. Results of chloramphenicol acetyltransferase (CAT) expression from the chimeric AAAT promoter-driven CAT reporter gene indicated that one protein binding site, from -68 to -26, was essential for the promoter activity. However, this protein binding site does not contain recognition sites of the transcription factors important for adipocyte differentiation, i.e., the C/EBP or PPAR family. Further analysis revealed that the DNA sequence, TTCAAGTCCCGCCCTCCGCT from -65 to -46, was the cis-element essential and partially sufficient for inducible activity of the AAAT gene promoter.
...
PMID:An SP1-like cis-element is the major DNA motif for differential expression regulation of the adipocyte amino acid transporter. 1077 87

Trypanosoma brucei regulates gene expression by post-transcriptional mechanisms, such as mRNA turnover and translation control. This regulation frequently requires specific sequences located in the 3'-untranslated region. Microarray analysis and Northern blot hybridization showed that the amino acid transporter 11 mRNA is up-regulated in insect stages of the parasite. By RT-PCR and sequencing, the AATP11 polyadenylation site was mapped. We show that this 3'-UTR causes higher expression of the chloramphenicol acetyltransferase (CAT) reporter gene in procyclic trypanosomes than in bloodstream forms. Results of deletion analysis suggested that multiple elements located between nucleotides 141 and 618 of the 3'-untranslated region are required for this control.
...
PMID:Regulation of an amino acid transporter mRNA in Trypanosoma brucei. 1799 63