Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Transcription of the thyroglobulin (TG) gene in rat thyroid FRTL-5 cells is stimulated by two hormones, TSH and insulin-like growth factor-I (IGF-I). The effect of TSH is mimicked by cAMP. Promoter regions of the rat TG gene responsible for hormonal action as well as the nuclear regulatory proteins that interact with these regions were characterized. Minimal promoter that responds to both hormones has been found to be up to -171 basepairs from the transcription initiation site. In DNase-I footprinting analysis, nuclear extracts from cells treated with either of these hormones protected the same two major regions within the minimal promoter. Mutations in these two regions abolished basal, TSH-stimulated, as well as IGF-I-stimulated expression of the fused reporter gene chloramphenicol acetyltransferase. DNA mobility shift assay revealed that cAMP and IGF-I induce binding of similar nuclear proteins to these promoter regions. These results suggest that rat TG gene transcription is regulated by the convergent action of two distinct signaling pathways, possibly involving similar DNA-binding nuclear proteins and regulatory sequences of the TG gene promoter.
Mol Endocrinol 1990 Dec
PMID:Similar nuclear factors mediate stimulation of rat thyroglobulin gene transcription by thyrotropin and insulin-like growth factor-I. 196 92

A bovine genomic library was constructed using a cosmid vector, pHC79, and bovine DNA partially digested by EcoRI. Bovine P-450(11 beta) cDNA, pcP-450(11 beta)-2 [Morohashi et al. (1987) J. Biochem. 102,559-568], was used as a probe for screening the genomic library. Ten clones carrying P-450(11 beta) genomic DNA were isolated from 8 x 10(4) colonies and classified into five groups (CB11 beta-1, CB11 beta-3, CB11 beta-7, CB11 beta-20, and CB11 beta-21) according to differences in the restriction endonuclease sites. Nucleotide sequences of amino acid coding regions of the five clones were determined by the dideoxy sequencing method using synthetic nucleotides corresponding to various parts of the cDNA as primers. The nucleotide sequences revealed that three clones, CB11 beta-1, CB11 beta-3, and CB11 beta-21, were pseudogenes. Amino acid sequences coded by the other two clones, CB11 beta-7 and CB11 beta-20, were identical with that coded by a previously described cDNA, pcP-450(11 beta)-3 [Kirita et al. (1988) J. Biochem. 104, 683-686]. The promoter regions of the five clones were introduced in front of chloramphenicol acetyltransferase (CAT) gene of pSV00CAT and used to examine P-450(11 beta) gene regulation in cultured cells. The five recombinant plasmids showed cAMP-responsive CAT activities in Y-1 cells, a cell strain derived from adrenal tumor. The induction rates of the recombinant plasmids carrying the promoters of normal genes, CB11 beta-7 and -20, were larger than those of pseudogenes, CB11 beta-1, -3, and -21. CAT activities expressed by the promoter regions of the normal genes in the presence or absence of cAMP in Y-1 cells were almost equal to that by the promoter region of human P-450(SCC) gene. Though the promoter of the P-450(SCC) gene also showed cAMP-responsive CAT activity in I-10 cells, a cell strain derived from Leyding cell tumor, P-450(11 beta) gene promoter did not express the activity in I-10 cells.
J Biochem 1990 Dec
PMID:Structural analysis of multiple bovine P-450(11 beta) genes and their promoter activities. 196 87

In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11 beta) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11 beta-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at -331 bp to -324 bp in the promoter region of the P-450(11 beta) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11 beta) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11 beta) gene, and named them Ad5 and Ad6.(ABSTRACT TRUNCATED AT 250 WORDS)
J Biochem 1990 Dec
PMID:Novel cAMP regulatory elements in the promoter region of bovine P-450(11 beta) gene. 196 88

A fusion protein was expressed in transgenic tobacco and yeast cells to examine the functional conservation of mechanisms for importing precursor proteins from the cytosol into mitochondria and chloroplasts. The test protein consisted of the mitochondrial leader peptide from the yeast precursor to cytochrome oxidase subunit Va (prC5) fused to the reporter protein chloramphenicol acetyltransferase. This protein, denoted prC5/CAT, was transported into the mitochondrial interior in yeast and tobacco cells. In both organisms, the mitochondrial form of prC5/CAT was smaller than the primary translation product, suggesting that proteolytic processing occurred during the transport process. prC5/CAT also was translocated into chloroplasts in vivo, accumulating to approximately the same levels as in plant mitochondria. However, accumulation of prC5/CAT in chloroplasts relative to mitochondria varied with the conditions under which plants were grown. The chloroplast form of prC5/CAT also appeared to have been proteolytically processed, yielding a mature protein of the same apparent size as that seen in mitochondria of either tobacco or yeast. Chloramphenicol acetyltransferase lacking a mitochondrial targeting peptide did not associate with either chloroplasts or mitochondria. The results demonstrated that in plant cells a single leader peptide can interact functionally with the protein translocation systems of both chloroplasts and mitochondria, and raised the possibility that certain native proteins might be shared between these two organelles.
Plant Cell 1990 Dec
PMID:A yeast mitochondrial leader peptide functions in vivo as a dual targeting signal for both chloroplasts and mitochondria. 196 76

Both cellular activation signals and exposure to glucocorticoids such as dexamethasone (Dex) cause programmed cell death in T cell hybridomas. When cells were activated in the presence of Dex, however, the degree of killing that was achieved by either stimulus alone was markedly reduced. Dex-induced programmed cell death of normal T cell clones was also prevented by cellular activation. Cyclosporin A (CsA) completely blocked the activation-induced death of T cell hybridomas, but actually enhanced the killing caused by Dex. The addition of CsA to activated T cell hybridomas in the presence of Dex allowed killing to proceed, consistent with ability of CsA to block activation-induced nuclear gene transcription. A number of independent approaches were used to explore the effect of activation on the glucocorticoid signaling/effector pathway. First, RU-486, which binds the glucocorticoid receptor and is a potent competitive antagonist of Dex, did not inhibit activation-induced cell killing. Second, activation of T cell hybridomas did not cause the translocation of the glucocorticoid receptor from the cytoplasm to the nucleus, nor did it prevent the receptor translocation induced by treatment with Dex. Finally, T cell hybridomas were transfected with a plasmid containing the chloramphenicol acetyltransferase (CAT) gene under the control of two tandemly arranged glucocorticoid-responsive elements. Activation of these cells did not induce CAT activity, and did not inhibit the CAT activity induced by Dex. In fact, there was a paradoxical increase in CAT activity when cells were treated with both stimuli. We conclude that cellular activation does not directly utilize the glucocorticoid receptor nor the glucocorticoid pathway when inducing programmed cell death. Furthermore, the ability of activation to inhibit Dex-mediated killing is not due to interference with the classical glucocorticoid signaling pathway, up to and including the initiation of gene transcription. Alternative mechanisms of antagonism, as well as the possible relevance of this phenomenon to the positive selection of self-recognizing thymocytes, are discussed.
J Immunol 1990 Dec 15
PMID:Programmed T lymphocyte death. Cell activation- and steroid-induced pathways are mutually antagonistic. 197 85

To study the regulation of insulin gene expression by physiological regulators, primary cultures of rat islet cells were transfected with portions of the rat insulin I gene 5'-flanking sequence linked to the reporter gene chloramphenicol acetyltransferase (CAT). Incubation of the cells in increasing glucose concentrations led to a parallel increase in both CAT activity and CAT mRNA levels. Pretreatment of the cells with the beta-cell-specific toxin streptozotocin reduced CAT activity 97%. Beta-Cell-specific expression of CAT was also demonstrated by co-staining the transfected cells with antisera to both CAT and insulin. Experiments showing a reduction in the response to glucose in the presence of the calcium channel blocker verapamil suggest that calcium plays a role in the glucose response, possibly via regulation of factors interacting with this limited portion of the insulin gene.
J Biol Chem 1990 Dec 25
PMID:Regulation of insulin gene expression by glucose and calcium in transfected primary islet cultures. 197 79

We showed previously that a gene construction that consisted of 5.2 kb of 5' flanking sequence, the first exon, and part of the first intron of the human gene encoding vasoactive intestinal peptide (VIP) fused to the reporter gene chloramphenicol acetyltransferase (CAT) fully mimicked the diverse behavior of the endogenous VIP gene when transfected into subclones of the human neuroblastoma cell line SK-N-SH (Waschek et al., 1988). To determine if the same sequences were sufficient to target expression of a reporter to VIP-producing tissues in the mouse, we initiated a pilot study in which we generated four transgenic mice or mouse lines that contained the VIPCAT fusion gene. Detectable levels of CAT were found in the ileum of either founder or offspring of each of the transgenic mouse lines. In all other tissues tested, CAT activity was either below the level of detection or the transgene was not expressed, with the exception of one mouse in which ectopic expression in the cerebellum was observed. The results indicate that the VIP sequences utilized were sufficient to direct expression of the transgene to the intestine, but not necessarily to other sites of VIP expression. To investigate what specific DNA sequences might confer VIP expression in the intestine and other sites, we analyzed further the VIP gene in SK-N-SH subclones using VIP/luciferase fusion gene constructions. A 0.6 kb DNA fragment located between 4.0 kb and 4.6 kb upstream from the VIP transcriptional start site was found to impart a high level of expression in one subclone and an increased degree of phorbol ester induction in another. These and other data indicate that multiple transcriptional elements control VIP expression in neuroblastoma cells and are candidates as mediators of VIP gene expression in the intact animal.
J Neurosci Res 1990 Dec
PMID:Expression of a chimeric VIP gene is targeted to the intestine in transgenic mice. 207 11

An abnormal human thyroid hormone beta-receptor (hTR beta-Mf), which has a glycine to arginine substitution in the hormone-binding domain, has been identified in affected members of one family with generalized resistance to thyroid hormone. To better understand the mechanism by which this mutation produces the observed abnormality, expression vectors for the wild-type and mutant thyroid hormone receptors (TRs) were prepared to test hormone-binding activity and trans-activation function. Nuclear extracts of COS-7 cells transfected with wild-type TRs showed specific T3-binding activity, while mutant receptor-transfected COS-7 nuclear extract failed to bind T3. On the other hand, in a avidin-biotin complex DNA-binding assay, in vitro translated hTR beta-Mf showed high binding activity to the thyroid hormone response element, which was indistinguishable from that of wild-type TRs. In a transient expression study, only the wild-type TRs activated a rat GH gene promoter-chloramphenicol acetyltransferase fusion gene in a T3-dependent manner. Additionally, when wild-type TR and hTR beta-Mf were cotransfected, hTR beta-Mf inhibited gene activation regulated by wild-type TRs. From these results we conclude that 1) hTR beta-Mf has no demonstrable T3 binding and appears to have minimal, if any, ability to activate a thyroid hormone-responsive gene in spite of its preserved ability to bind to a TRE in DNA; 2) hTR beta-Mf inhibits the transcriptional activation of a thyroid hormone-responsive gene by the wild-type TRs in a dominant manner; and 3) the dominant negative regulatory function of hTR beta-Mf appears to explain the clinical manifestations of thyroid hormone resistance produced by this mutation when present in the heterozygous state.
Mol Endocrinol 1990 Dec
PMID:Dominant negative transcriptional regulation by a mutant thyroid hormone receptor-beta in a family with generalized resistance to thyroid hormone. 208 93

The brief study described in this report was undertaken to determine whether cyclosporin A had any direct effect on the expression of tubulointerstitial procollagens in cultured renal cells. Our findings indicate that murine tubulointerstitial fibroblasts secreted significantly more procollagen type I after the addition of cyclosporin A, whereas syngeneic proximal tubular cells expressed significantly more types I and IV procollagen after cyclosporin stimulation. These increases in procollagen gene product correlated concordantly with changes in the levels of cytoplasmic mRNA with procollagen-specific cDNA probes. Transfection of these fibroblasts and proximal tubular cells with chimeric gene constructs containing enhancer/promoter elements for alpha2(I) and alpha 1(IV) procollagen linked to a chloramphenicol acetyltransferase reporter gene indicates that the stimulatory effect of cyclosporin on procollagen expression depends, at least to some extent, on an increase in transcriptional activity.
J Am Soc Nephrol 1990 Dec
PMID:Cyclosporin A stimulates transcription and procollagen secretion in tubulointerstitial fibroblasts and proximal tubular cells. 210 51

The major cytoskeletal actin gene of Drosophila melanogaster, the actin 5C gene, has two promoters, the distal one of which controls synthesis of actin in a tissue- and developmental stage-specific manner. This very strong promoter has widely been used for expression of heterologous genes in cultured cells. To locate functional regulatory elements in this distal promoter, mutants of the promoter were fused to the bacterial chloramphenicol acetyltransferase gene and assayed for transient expression activity in cultured Drosophila embryonic Schneider line 2 cells. The results showed that the upstream end of the promoter extends to 522 bp from the transcription start site. In addition, there are two remote activating regions about 2 kb upstream. Between -522 and -379 are two regions that exert a strong negative effect. Downstream from these negative regions are at least six positive regions and a TATA element. The strongest positive determinant of the promoter was identified at -320 as AAAATGTG by footprinting and by a replacement experiment. When the relevant region was replaced by a synthetic sequence containing this element in a random context, the transient expression activity was restored. The sequence TGTATG located at -355 was also identified as a positive element by a similar replacement approach. Apparently the very high activity of this promoter is the result of the combined activities of multiple factors.
Mol Cell Biol 1990 Dec
PMID:Positive and negative regulatory elements mediating transcription from the Drosophila melanogaster actin 5C distal promoter. 212 90


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>