Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
 5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Expression of the prokaryotic gene for chloramphenicol acetyltransferase (EC 2.3.1.28) (CAT) in primate cells transfected with X-irradiated plasmid pSV2CAT was determined in transient expression assays. CAT expression did not depend upon the presence of supercoiled plasmids, but relaxed circular forms were essential. X-ray conversion of relaxed circles to linear forms paralleled the loss of CAT expression, with identical D0's in the first part of dose-response curves. X-ray-induced loss of supercoiled forms was complete at much lower doses. The D0 for inactivation of CAT expression by X irradiation of the plasmids in 1 mM Tris buffer was 270 Gy; it was 13 Gy for plasmids irradiated in water. The D0's for conversion of pSV2CAT to relaxed circle forms were only one-seventh as large as the D0's for CAT inactivation after X-ray in water or in 1 mM Tris buffer. Expression of the CAT gene in some representative repair-deficient human fibroblasts transfected with X-irradiated pSV2CAT was less than in monkey CV-1 cells or cell lines from normal human subjects. These results demonstrate a novel means to study low levels of X-ray damage in DNA correlating specific X-ray damage in the DNA with expression of the gene in unirradiated primate cells.
 ...
PMID:Expression of prokaryotic genes after transfection of X-irradiated plasmids into primate cells. 281 35

We report the purification of chloramphenicol acetyltransferase (acetyl-CoA:chloramphenicol 3-O-acetyltransferase, EC 2.3.1.28) by a two-step procecdure involving chromatography on a Sepharose 4B-reduced chloramphenicol matrix and DEAE-Sephadex A-50. This procedure resulted in a 120-fold purification with 50% recovery of the enzyme. Only one band of enzyme activity was present after electrophoresis on polyacrylamide gel. The enzyme is active over a broad pH range, maximal activity being observed near pH 7.6. Both chloramphenicol 1-acetate of chloramphenicol 3-acetate were found to be very stable in Tris-maleate buffer at pH 6.09 with negligible interconversion. The incubation at pH 6.0 of chloramphenicol 1-acetate with the purified chloramphenicol acetyltransferase yielded chloramphenicol 1,3-diacetate. These data indicate that the enzyme acetylates specifically at the 3-hydroxy position and the diacetylation is possible only because of non-enzymatic interconversion of chloramphenicol 3-acetate to chloramphenicol 1-acetate at higher pH values.
 ...
PMID:A study of the enzymatic inactivation of chloramphenicol by highly purified chloramphenicol acetyltransferase. 699 33

The promoter of the murine c-Ki-ras proto-oncogene contains a critical homopurine-homopyrimidine sequence which is recognized by a protein factor and is a potential site for triplex-forming oligonucleotides (TFOs). The TFOs designed to bind this critical c-Ki-ras target have either an AG or a GT sequence motif. Of the two types, the first is found to form triplexes with extraordinarily high stability. For instance, both d(AGGGAGGGAGGAAGGGAGGG) (20AG) and d(GGGAGGGAGGGAAGGAGGGAGGGAGGGAGC) (30AG) are able to bind the c-Ki-ras target at 65 degrees C and to resist a polyacrylamide gel temperature of 55 degrees C. By contrast, the triplex formed by d(TGGGTGGGTGGTTGGGTGGG) (20GT) is largely dissociated at a gel temperature of 55 degrees C. The affinity constants of the TFOs at 37 degrees C, 50 mM Tris-HCl, pH 7.4, 50 mM NaCl, 5 mM MgCl2 (standard buffer) were determined through band-shift experiments and found to be respectively 1.0 x 10(6), 4.0 x 10(6), and 2.5 x 10(7) M-1 for 20GT, 30AG, and 20AG. The AG-triplexes exhibit in standard buffer monophasic melting profiles (Tm approximately 75 degrees C) and circular dichoroism spectra showing the typical negative ellipticity at 212 nm, which is a hallmark for triplex DNA. The rate at which the TFOs bind to the c-Ki-ras target at 37 degrees C was examined under pseudo-first-order conditions. When the TFOs are in excess over the target and in the micromolar concentration range, the kinetics of triplex formation are slow, characterized by association half-lives of about 1 h. The ability of the TFOs to act as artificial transcription repressors was examined in a cellular system employing transient transfection experiments. Cultured NIH 3T3 fibroblast cells were cotransfected with a DNA mixture composed by a TFO and plasmid pKRS-413 containing the chloramphenicol acetyltransferase (CAT) gene driven by the c-Ki-ras promoter. It was found that the CAT activity is specifically inhibited by the TFOs in a dose-dependent manner. As expected, stronger CAT repression is obtained with 20AG, the oligonucleotide which forms the more stable triplex. These data suggest that (A,G)-oligonucleotides may provide a valuable means for the selective repression of the c-Ki-ras gene expression.
 ...
PMID:(A,G)-oligonucleotides form extraordinary stable triple helices with a critical R.Y sequence of the murine c-Ki-ras promoter and inhibit transcription in transfected NIH 3T3 cells. 897 12