Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
 5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The promoter of the murine c-Ki-ras proto-oncogene contains a critical homopurine-homopyrimidine sequence which is recognized by a protein factor and is a potential site for triplex-forming oligonucleotides (TFOs). The TFOs designed to bind this critical c-Ki-ras target have either an AG or a GT sequence motif. Of the two types, the first is found to form triplexes with extraordinarily high stability. For instance, both d(AGGGAGGGAGGAAGGGAGGG) (20AG) and d(GGGAGGGAGGGAAGGAGGGAGGGAGGGAGC) (30AG) are able to bind the c-Ki-ras target at 65 degrees C and to resist a polyacrylamide gel temperature of 55 degrees C. By contrast, the triplex formed by d(TGGGTGGGTGGTTGGGTGGG) (20GT) is largely dissociated at a gel temperature of 55 degrees C. The affinity constants of the TFOs at 37 degrees C, 50 mM Tris-HCl, pH 7.4, 50 mM NaCl, 5 mM MgCl2 (standard buffer) were determined through band-shift experiments and found to be respectively 1.0 x 10(6), 4.0 x 10(6), and 2.5 x 10(7) M-1 for 20GT, 30AG, and 20AG. The AG-triplexes exhibit in standard buffer monophasic melting profiles (Tm approximately 75 degrees C) and circular dichoroism spectra showing the typical negative ellipticity at 212 nm, which is a hallmark for triplex DNA. The rate at which the TFOs bind to the c-Ki-ras target at 37 degrees C was examined under pseudo-first-order conditions. When the TFOs are in excess over the target and in the micromolar concentration range, the kinetics of triplex formation are slow, characterized by association half-lives of about 1 h. The ability of the TFOs to act as artificial transcription repressors was examined in a cellular system employing transient transfection experiments. Cultured NIH 3T3 fibroblast cells were cotransfected with a DNA mixture composed by a TFO and plasmid pKRS-413 containing the chloramphenicol acetyltransferase (CAT) gene driven by the c-Ki-ras promoter. It was found that the CAT activity is specifically inhibited by the TFOs in a dose-dependent manner. As expected, stronger CAT repression is obtained with 20AG, the oligonucleotide which forms the more stable triplex. These data suggest that (A,G)-oligonucleotides may provide a valuable means for the selective repression of the c-Ki-ras gene expression.
 ...
PMID:(A,G)-oligonucleotides form extraordinary stable triple helices with a critical R.Y sequence of the murine c-Ki-ras promoter and inhibit transcription in transfected NIH 3T3 cells. 897 12

We investigated the inhibitory effects of intracellular cyclic adenosine monophosphate (cAMP) levels in regulating class 3 aldehyde dehydrogenase (aldh3) gene expression using cultures of primary rat hepatocytes and transient transfection experiments with HepG2 cells. In addition to regulation by an Ah receptor-dependent mechanism, expression of many members of the Ah gene battery have been shown to be negatively regulated. As was seen for the cytochrome P450 (cyp1A1) gene, aldh3 is transcriptionally inducible by polycyclic aromatic hydrocarbons (PAH), and this induction involving function of the arylhydrocarbon (Ah) receptor is inhibited by the protein kinase C (PKC) inhibitors, 1-(5-isoquinolinesulfonyl)-2-methylpiperazine di-HCl (H7) and staurosporine. However, PAH induction of ALDH-3 activity, protein, and mRNA was potentiated 2-4-fold by addition of the protein kinase A (PKA) inhibitors, N-(2-(methylamino)ethyl)-5-isoquinolinesulfonamide di-HCl (H8) and N-(2-guanidinoethyl)-5-isoquinolinesulfonamide HCl (HA1004). These PKA inhibitors had no effect on the PAH induction of the cyp1A1. Protein kinase A activity of cultured hepatocytes was specifically inhibited by H8 and HA1004 in a concentration-dependent manner, but not by H7, and there was an inverse correlation observed between potentiation of PAH-induced aldh3 gene expression and inhibition of specific PKA activity by the PKA inhibitors. The cAMP analog dibutyryl cAMP, the adenylate cyclase activator forskolin, and the protein phosphatase 1 and 2A inhibitor okadaic acid all dramatically inhibited both PAH induction and H8 potentiation of PAH induction of aldh3 expression but had no effect on induction of cyp1A1 expression in cultured hepatocytes. Both basal and PAH-dependent expression of a chloramphenicol acetyltransferase expression plasmid containing approximately 3.5 kilobase pairs of the 5'-flanking region of aldh3 (pALDH3.5CAT) were enhanced 3-4-fold by the PKA inhibitor H8 but not by the PKC inhibitor H7 (>20 microM). cAMP analogs, activators of PKA activity, or protein phosphatase inhibitors diminished expression of the reporter gene in a manner identical to the native gene in cultured rat hepatocytes. Using deletion analysis of the pALDH3.5CAT construct, we demonstrated the existence of a negative regulatory region in the 5'-flanking region between -1057 and -991 base pairs which appears to be responsible for the cAMP-dependent regulation of this gene under both basal and PAH-induced conditions. At least two apparently independent mechanisms which involve protein phosphorylation regulate aldh3 expression. One involves function of the Ah receptor which requires PKC protein phosphorylation to positively regulate both aldh3 and cyp1A1 gene expression and the other a cAMP-responsive process which allows PKA activity to negatively regulate expression of aldh3 under either basal or inducible conditions.
 ...
PMID:cAMP-dependent negative regulation of rat aldehyde dehydrogenase class 3 gene expression. 901 60

Studies were designed to examine the regulation of apolipoprotein (apo) A-I gene expression in Cu-depleted Hep G2 cells. The cupruretic chelator N,N'-bis(2-aminoethyl)-1,3-propanediamine 4 HCl (2,3,2-tetramine or TETA) was used to maintain a 77% reduction in cellular Cu in Hep G2 cells. After two passages of TETA treatment, the relative abundance of apoA-I mRNA was elevated 52%. In TETA-treated cells, the rate of apoA-I mRNA decay measured by an actinomycin D chase study was accelerated 108%, and the synthesis of apoA-I mRNA determined by a nuclear runoff assay was enhanced 2.5-fold in TETA-treated cells. All of those changes could be reverted toward the control values with Cu supplementation for only 2 days. In transient transfection assays, a 26.7% increase in chloramphenicol O-acetyltransferase (CAT) activity for the reporter construct -256AI-CAT was observed in the treated cells. However, the ability of apoA-I regulatory protein 1 (ARP-1) to repress the CAT activity was not affected by the depressed Cu status. In addition, gel retardation experiments demonstrated that Cu depletion enhanced the binding of hepatocyte nuclear factor 4 (HNF-4) and other undefined nuclear factors to oligonucleotides containing site A, one of three regulatory sites of the apoA-I gene promoter. Moreover, the relative abundance of HNF-4 mRNA was increased 58% in the Cu-depleted cells. Thus the observed increase in apoA-I gene transcription may be mediated mostly by an elevated level of the regulatory factor, HNF-4. In summary, the present findings established the mechanism by which a depressed cellular Cu status can enhance apoA-I mRNA production and subsequently increase apoA-I synthesis.
 ...
PMID:Regulation of apolipoprotein A-I gene expression in Hep G2 cells depleted of Cu by cupruretic tetramine. 935 82