Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Skeletal alpha-actin mRNA increases in the adult heart during cardiac hypertrophy after the imposition of hemodynamic overload/aortic restriction. 3,3',5-Triiodo-L-thyronine (T3) elicits a cardiac response similar to the effect of prolonged exercise and was recently shown to cause a rapid increase in the amount of skeletal alpha-actin mRNA in hearts from normal and hypophysectomized animals. We used transient transfection analysis to show that T3 induces the expression of the native skeletal alpha-actin promoter between nucleotide positions -2000 and +239 linked to the chloramphenicol acetyltransferase reporter gene in COS-1 fibroblasts and myogenic C2C12 cells. This T3 (10-100 nM)-induced transcriptional activation is dependent on the expression of the thyroid hormone receptors from transfected alpha 1 and beta 1 c-erbA complementary DNA expression vectors. Electrophoretic mobility shift assays were used to identify a thyroid hormone response element (TRE) in the human skeletal alpha-actin gene. This TRE is located between nucleotide positions -173 and -149 with respect to the start of transcription at +1 (5' TGGTCAACGCAGGGGACCCGGGCGG 3'). Electrophoretic mobility shift assay experiments showed that the putative skeletal alpha-actin TRE and defined rodent growth hormone TREs (that bind thyroid hormone receptors in vitro and in vivo) interacted with an identical nuclear factor in vitro in muscle cells that was developmentally regulated during myogenesis. Transient transfection analysis utilizing 5' unidirectional deletions of the skeletal alpha-actin promoter indicated that cis-acting sequences between nucleotide positions -432 and -153, which encompassed the TRE, were required for T3/thyroid hormone receptor-dependent trans-activation in vivo. Furthermore, we demonstrated that the skeletal alpha-actin TRE is juxtaposed next to SRF and SpI binding sites, at its 5' and 3' flanks, respectively. It is also surrounded by sequences densely populated by other SpI, SRF, and CTF binding sites. In conclusion, these results indicate that T3-induced increases in alpha-actin mRNA in animals are mediated by a direct transcriptional mechanism that may involve interactions with ubiquitous proteins.
...
PMID:The human skeletal alpha-actin promoter is regulated by thyroid hormone: identification of a thyroid hormone response element. 131 69

Several endocrine hormones which influence liver metabolism are known to increase in activity during the acute phase of injury or inflammation. We determined whether these hormones have the potential to influence acute-phase protein production in human and rat hepatoma cells. Catecholamines, glucagon, growth hormone, triiodothyronine, and cyclic nucleotides individually or in combination did not modulate the basal or the interleukin-1 (IL-1)-, IL-6-, and dexamethasone-stimulated levels of acute-phase plasma proteins. Insulin, however, was found to be a rapid, nonspecific, and dose-dependent inhibitor of the cytokine and glucocorticoid stimulation of acute-phase protein gene expression and to exert its effect at the transcriptional level. The insulin inhibition applied to all cytokines tested but to various degrees, depending upon the particular acute-phase gene. Insulin resulted in an early and prominent increase in the transcription of genes encoding the AP-1 components of JunA, JunB, and c-Fos, as has been observed for other growth factors. However, the effect of insulin on C/EBP beta was unexpected and paradoxical: while insulin completely inhibited the transcriptional activation of the C/EBP beta gene in cytokine- and dexamethasone-treated cells, the level of cytoplasmic C/EBP beta RNA was elevated. Quantitation of C/EBP beta mRNA by Northern (RNA) blot analysis and of C/EBP beta DNA binding activity by Southwestern (DNA-protein) blot analysis showed that insulin, when combined with cytokines and dexamethasone, stimulated both the mRNA and DNA binding activity by a factor of 1.6 compared with that of cells treated with cytokines and dexamethasone alone. Transient transfection of H-35 and HepG2 cells with a chloramphenicol acetyltransferase (CAT) gene expression vector containing the C/EBP beta response element also resulted in a 1.5-fold increase of C/EBP beta-mediated transcription in insulin-treated cells. Transfection of CAT gene constructs containing increasing lengths of heptaglobin gene 5' flanking sequences indicated that insulin inhibition of IL-6 stimulation required the presence of the region from -4100 to -1030. These results suggest that insulin has the potential to control the transcription of acute-phase genes by at least two separate mechanisms.
...
PMID:Insulin is a prominent modulator of the cytokine-stimulated expression of acute-phase plasma protein genes. 137 89

We used an enhancerless U3 mutant retroviral vector to deliver chimeras of the phosphoenolpyruvate carboxykinase (PEPCK) promoter region to a renal epithelial cell line capable of expressing PEPCK mRNA. Chimeras consisting of the PEPCK promoter and chloramphenicol acetyltransferase, neomycin phosphotransferase or human growth hormone genes were expressed after viral infection of the NRK52E renal epithelial cell line. Virus-delivered sequences in which the direction of PEPCK promoter transcription was antegrade to the normal direction of the long terminal repeat (LTR)-initiated transcription correctly upon stimulation with dexamethasone or 8-bromo cyclic AMP and upon lowering of the extracellular pH. Fluorescent primer extension in situ using primers specific for virus-delivered sequences of antegrade constructs indicated that a large fraction of NRK52E cells could be infected by co-cultivation with virus-producing psi-2 cells without G418 selection. Virus-delivered constructs whose orientation was opposite to that of the LTRs were expressed at very low levels, with transcripts detectable by PCR only in RNA from cyclic AMP-treated cells. Using reverse transcription/PCR, we demonstrated that the chimeric transcripts were from the internal PEPCK promoter rather than a functional or reconstituted Moloney LTR. PEPCK-reporter chimeras delivered by retroviral vectors demonstrated a level of expression more consistent with the level of expression of the native PEPCK gene than did transfected chimeras. This expression system should prove useful for studies of the physiological modulation of gene expression in renal tissues.
...
PMID:Expression of phosphoenolpyruvate carboxykinase (PEPCK) chimeras in renal epithelial cells. Retention of appropriate physiological responsiveness using enhancerless retroviral vectors. 137 12

Viruses that establish persistent infections may show selective and unique effects on the host's transcriptional machinery. Lymphocytic choriomeningitis virus (LCMV), a noncytolytic virus, can persistently infect a rat pituitary cell line. Although the infected cells remain free of structural damage, virus markedly interferes with growth hormone (GH) but only minimally interferes with prolactin transcription. The study of GH promoter-chloramphenicol acetyltransferase-transfected cells and GH promoter deletion mutants demonstrates that the viral effect is at the level of GH promoter and is due to interference with GH transactivator factor GHF1 (Pit1). Treatment of LCMV-infected cells with the antiviral agent ribavirin cures the infection and restores normal GH mRNA levels. These results illustrate a molecular mechanism by which a virus infection can disrupt synthesis of a cell's differentiated product without perturbing vital cellular functions.
...
PMID:Selective disruption of growth hormone transcription machinery by viral infection. 140 23

Activin A is a potent growth and differentiation factor related to transforming growth factor beta. In somatotrophs, activin suppresses the biosynthesis and secretion of growth hormone (GH) and cellular proliferation. We report here that, in MtTW15 somatotrophic tumor cells, activin decreased GH mRNA levels and inhibited expression of transfected GH promoter--chloramphenicol acetyltransferase fusion genes. Deletion mapping of nucleotide sequences mediating this inhibition led to the identification of a region that has previously been characterized as binding the pituitary-specific transcription factor Pit-1/GHF-1. Characterization of nuclear factor binding to this region demonstrated that binding of Pit-1 to the GH promoter is lost on activin treatment. These results indicate that activin-induced repression of GH biosynthesis is mediated by the loss of tissue-specific transcription factor binding to the GH promoter and suggest a possible general mechanism for other activin responses, whereby activin regulates the function of other POU- or homeodomain-containing transcription factors.
...
PMID:Activin inhibits binding of transcription factor Pit-1 to the growth hormone promoter. 145 33

Oncogenic activation of ras results in changes in the transcription of several genes leading to uncontrolled cell growth. In this paper, we demonstrate that transformation of fibroblast cells by the ras oncogene leads to transcriptional repression of the smooth muscle alpha-actin promoter. Transient transfection analysis of plasmids containing the 5' upstream region of the human alpha-actin gene fused to human growth hormone or bacterial chloramphenicol acetyltransferase coding sequences into Rat-2 and ras-transformed Rat-2 (HO6) cells indicates that alpha-actin promoter is repressed in ras-transformed cells. In addition, stable rat fibroblast cell lines expressing human growth hormone or beta-galactosidase under the control of alpha-actin promoter exhibit repressed reporter gene activity following transformation by the ras oncogene. alpha-Actin promoter-driven beta-galactosidase activity is derepressed in revertants of ras-transformed stable cell lines. This revertant cell line expresses elevated levels of ras p21 protein and is resistant to retransformation by Ki and Ha-ras oncogenes. The revertant may have either a defective target protein whose activity is essential for the transforming activity of ras or an activated tumor suppressor gene which can suppress the activity of ras. These results indicate that smooth muscle alpha-actin promoter activity is a sensitive marker to follow phenotypic changes following transformation by ras and subsequent reversion. The advantages of this alpha-actin promoter-reporter gene assay system to screen for drugs that inhibit the transforming activity of ras, either directly or indirectly, are discussed.
...
PMID:Regulation of smooth muscle alpha-actin promoter in ras-transformed cells: usefulness for setting up reporter gene-based assay system for drug screening. 145 76

We have isolated non-globin cDNA clones specific for erythroid differentiation from K562 human erythroleukemia cells and have identified those that may regulate globin gene transcription. A cDNA library was constructed from K562 cells induced by hemin for production of embryonic and fetal hemoglobins and screened against cDNA from uninduced K562 cells. Full-length clones specific for induced K562 cells were ligated into a eukaryotic expression vector and transfected into HeLa cells to allow for production of the corresponding coded polypeptide. The ability to increase epsilon- or gamma-globin promoter activity was identified using cotransfection with a second vector containing a globin gene promoter fused to a reporter gene. Six of the induced K562-specific clones exhibited the ability to increase the levels of the reporter genes, bacterial chloramphenicol acetyltransferase and human growth hormone. Sequencing analyses of these clones indicated that five were homologous to ferritin heavy and light chains and one had no homology with known DNA or protein sequences. The ferritin light chain cDNA had the greatest effect on globin gene promoter activation, increasing the gamma-globin promoter activity by 6-8-fold. The activation of the globin gene promoter in the absence of globin gene translation suggests that ferritin (or iron) may have a direct role in globin gene transcription. The subtractive library cloning strategy has enabled us to isolate cDNA clones that activate specific gene promoter without the requirement of direct DNA binding. This approach may allow further identification of the genes encoding proteins that are involved in the control of erythropoiesis.
...
PMID:Activation of globin gene expression by cDNAs from induced K562 cells. Evidence for involvement of ferritin in globin gene expression. 184 May 94

Infection with human herpesvirus 6 (HHV-6) was found to up-regulate expression of human immunodeficiency virus and human T cell leukaemia virus type I (HTLV-I) long terminal repeat sequence (LTR), and herpes simplex virus type 1 (HSV-1) gD chloramphenicol acetyltransferase (CAT) constructs transfected into the T cell line, J. Jhan. Activation by HHV-6 was due to one or more viral proteins produced early in infection and, in the case of the HTLV-I LTR, was synergistic to induction mediated by the HTLV-I tax gene product. Neither the HTLV-I enhancer nor basal promoter elements of the HSV-1 gD gene were essential for activation and no increase in accumulated HTLV-I mRNA was observed due to HHV-6 infection. Induction by HHV-6 was found to be dependent on the reporter construct used, because the CAT gene and, to a lesser extent, the HSV-1 thymidine kinase gene were responsive to HHV-6 infection although no significant activation of growth hormone constructs was observed. Our results bear a strong resemblance to those obtained for the Epstein-Barr virus BMLF1 gene, indicating that the major HHV-6 trans-activator may be a homologue of this gene.
...
PMID:Activation of gene expression by human herpesvirus 6 is reporter gene-dependent. 185 12

Bovine aortic endothelial (BAE) cells spontaneously form structures in vitro that resemble capillary-like cords or tubes. This process is associated with changes in the expression of certain extracellular matrix proteins that include type I collagen. BAE cells exhibiting angiogenesis in vitro were transfected with plasmids containing either chloramphenicol acetyltransferase or human growth hormone genes directed by promoter sequences from the human alpha 1(I)-collagen gene. Immunostaining for chloramphenicol acetyltransferase demonstrated that collagen promoter activity was restricted to cells involved in the formation of endothelial cords. In comparison to transfected monolayers of BAE cells, the transcriptional activity of the alpha 1(I)-collagen promoter increased by 7-fold in cultures undergoing angiogenesis in vitro. The selective ability of angiogenic endothelium to utilize the alpha 1(I)-collagen promoter is consistent with previous studies showing high levels of alpha 1(I)-collagen mRNA in BAE cells actively engaged in the formation of tubes (Iruela-Arispe, L., Hasselaar, P., and Sage, H. (1991) Lab. Invest. 64, 174-186). We conclude that transcriptional activation of the alpha 1(I)-collagen gene is closely linked to the morphologic alterations in cellular phenotype that accompany the transition of quiescent endothelial monolayers to the angiogenic state.
...
PMID:Transcriptional activity of the alpha 1(I)-collagen promoter is correlated with the formation of capillary-like structures by endothelial cells in vitro. 191 59

We have constructed a new pair of plasmid vectors for the efficient expression of mammalian genes. The first of the new plasmids, pAVE1, was derived from pCMVcat [Foecking and Hofstetter, Gene 45 (1986) 101-105] by replacing the chloramphenicol acetyltransferase-encoding sequences in the latter for a multiple cloning site. Since it possesses the powerful enhancer-promoter unit of the immediate early gene of human cytomegalovirus, pAVE1 is ideal for the expression of mammalian genes. The second expression vector, pAVE2, resulted when the 3'-end flanking region from the human growth hormone-encoding gene (hGH) was incorporated in pAVE1. This region provides sequences for 3'-end processing and polyadenylation of primary transcripts. Thus, pAVE2 is suitable for expression of cDNAs in cultured cells, where introns have little effect on gene expression. To test our new vectors, we inserted the structural region of the chromosomal hGH gene into pAVE1, and its cDNA into pAVE2. By independently transfecting the resulting recombinant plasmids into COS-7 cells, we have achieved high levels of hGH transient expression with both vectors.
...
PMID:New vectors for the efficient expression of mammalian genes in cultured cells. 215 29


1 2 3 4 5 6 7 8 Next >>

---