Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Skeletal alpha-actin mRNA increases in the adult heart during cardiac hypertrophy after the imposition of hemodynamic overload/aortic restriction. 3,3',5-Triiodo-L-thyronine (T3) elicits a cardiac response similar to the effect of prolonged exercise and was recently shown to cause a rapid increase in the amount of skeletal alpha-actin mRNA in hearts from normal and hypophysectomized animals. We used transient transfection analysis to show that T3 induces the expression of the native skeletal alpha-actin promoter between nucleotide positions -2000 and +239 linked to the chloramphenicol acetyltransferase reporter gene in COS-1 fibroblasts and myogenic C2C12 cells. This T3 (10-100 nM)-induced transcriptional activation is dependent on the expression of the thyroid hormone receptors from transfected alpha 1 and beta 1 c-erbA complementary DNA expression vectors. Electrophoretic mobility shift assays were used to identify a thyroid hormone response element (TRE) in the human skeletal alpha-actin gene. This TRE is located between nucleotide positions -173 and -149 with respect to the start of transcription at +1 (5' TGGTCAACGCAGGGGACCCGGGCGG 3'). Electrophoretic mobility shift assay experiments showed that the putative skeletal alpha-actin TRE and defined rodent growth hormone TREs (that bind thyroid hormone receptors in vitro and in vivo) interacted with an identical nuclear factor in vitro in muscle cells that was developmentally regulated during myogenesis. Transient transfection analysis utilizing 5' unidirectional deletions of the skeletal alpha-actin promoter indicated that cis-acting sequences between nucleotide positions -432 and -153, which encompassed the TRE, were required for T3/thyroid hormone receptor-dependent trans-activation in vivo. Furthermore, we demonstrated that the skeletal alpha-actin TRE is juxtaposed next to SRF and SpI binding sites, at its 5' and 3' flanks, respectively. It is also surrounded by sequences densely populated by other SpI, SRF, and CTF binding sites. In conclusion, these results indicate that T3-induced increases in alpha-actin mRNA in animals are mediated by a direct transcriptional mechanism that may involve interactions with ubiquitous proteins.
...
PMID:The human skeletal alpha-actin promoter is regulated by thyroid hormone: identification of a thyroid hormone response element. 131 69

Thyroid hormone regulation of the human thyrotropin beta-subunit gene (TSH beta) was examined in a human embryonal cell line (293). Transient expression studies were performed with chimeric plasmids containing the reporter gene, chloramphenicol acetyltransferase. Sequences in the first exon between +9 and +37 base pairs (bp) enhanced gene expression from the human TSH beta promoter in the absence of thyroid hormone as well as mediated a concentration-dependent triiodothyronine (L-T3) decrease in gene expression. Thyroid hormone inhibition of expression was also conferred to the herpes simplex virus thymidine kinase promoter by inserting +3 to +37 bp of the human TSH beta gene downstream from the start of transcription. Primer extension analysis of RNA from transfected cell cultures revealed accurate transcription initiation in only those constructs which contained sequences between +9 and +37 bp. Moreover, RNA analysis confirmed that L-T3 inhibition of chloramphenicol acetyltransferase activity from chimeric pTSH beta CAT constructs occurred at a pretranslational level. In addition, a nuclear thyroid hormone receptor, c-erbA-beta, bound to this region in an avidin-biotin DNA binding assay. These data suggest that L-T3, bound to its receptor, may inhibit human TSH beta expression by interfering with an element that functions to enhance gene expression.
...
PMID:Thyroid hormone inhibition of human thyrotropin beta-subunit gene expression is mediated by a cis-acting element located in the first exon. 276 33

In GC cells, a growth hormone-producing rat pituitary cell line, 3,5,3'-triiodo-L-thyronine (L-T3) rapidly stimulates the transcription rate of the growth hormone gene which parallels the level of chromatin-associated L-T3-receptor complexes (Yaffe, B. M., and Samuels, H. H. (1984) J. Biol. Chem. 259, 6284-6291). In this study we have functionally mapped the elements of the gene which are involved in mediating basal and hormone-regulated expression. Stable transformation studies indicate that transcriptional regulation of the gene by L-T3 is mediated by sequences in the 5'-flanking region. Transient expression studies were performed using a series of chimeric plasmids in which 5'-flanking DNA was ligated to the chloramphenicol acetyltransferase gene. Transient expression occurred only in cells which expressed the endogenous growth hormone gene. Sequences between -104 and +7 were found to be essential for basal expression. One of the most highly conserved regions (-105 to -145) contains elements which further enhance the level of basal expression but are not necessary for regulated expression by L-T3. DNA between -210 and -181 was found to be essential for stimulation by L-T3 and was shown to function most efficiently with the homologous rat growth hormone promoter (-104 to +7). Sequences from -206 to -198 show about 80% homology with a sequence in the 5'-flanking region of two other rat genes which are regulated by thyroid hormone. Glucocorticoid hormones, which also transcriptionally stimulate the rat growth hormone gene, elicited only minimal effects in both stable and transient expression studies. This suggests that the elements which mediate glucocorticoid regulation of the endogenous gene are found either upstream of the cloned 5'-flanking region (1800 base pairs) or 3' of the cap site.
...
PMID:cis-acting elements of the rat growth hormone gene which mediate basal and regulated expression by thyroid hormone. 347 59

Thyroid hormone exerts marked effects on cardiovascular function. Expression of cardiac alpha- and beta-myosin heavy chain (MHC) isoforms can be altered in response to thyroid hormone as well as by hemodynamic changes imposed on the heart. The molecular mechanisms that mediate these changes are not completely known. We studied the contractile and thyroid hormone responsiveness of the betaMHC promoter in both cultured cardiac myocytes and in vivo by direct DNA transfer. Using transient transfection of neonatal rat cardiomyocytes, the activities of recombinant reporter plasmids containing betaMHC 5'-flanking sequences terminating at positions -2250, -1145, -670, and -354 were decreased significantly in cultures containing L-T3 (50 nM). Similar deletion analysis showed that 5'-flanking regions terminating within -2250 to -151 bp were contractility responsive; however, deletion to position -126 attenuated this response. In vivo betaMHC promoter activity, determined by injecting the recombinant plasmid into the myocardium, was significantly higher by 2-fold in hyperthyroid than in euthyroid ventricles (2.47 +/- 0.41 vs. 1.33 +/- 0.25 luciferase/ chloramphenicol acetyltransferase; P<0.05). Increased ventricular workload, produced by aortic coarctation for 5 days, resulted in ventricular hypertrophy (heart/body weight, 4.05 +/- 0.19 vs. 3.42 +/- 0.16 mg/g; P < 0.02) and a 3.4-fold increase in betaMHC messenger RNA content. However, betaMHC promoter activity in vivo was not significantly different between rats experiencing aortic coarctation and sham-operated rats (1.49 +/- 0.41 vs. 0.96 +/- 0.27 luciferase chloramphenicol acetyltransferase, respectively) and was similar to that in euthyroid animals. These results show that betaMHC promoter activity is T3 responsive in cultured myocytes and in vivo, but that the increase in betaMHC messenger RNA observed in the in vivo pressure overloaded myocardium cannot be explained entirely by transcription control mechanisms.
...
PMID:Thyroid hormone and hemodynamic regulation of beta-myosin heavy chain promoter in the heart. 860 87

Although L-triiodothyronine (L-T3) lowers cholesterol, this hormone is not used to treat hypercholesterolemia because of its cardiotoxic effects. Thyromimetics, such as the novel compound CGS 23425, that mimic the beneficial but lack the detrimental effects of T3, may be useful in the treatment of hypercholesterolemia. To show that CGS 23425 has no cardiotoxicity, atrial contractility and force were both measured and found to be unchanged in rats treated with up to 10 mg/kg drug. The lipid lowering actions of this drug resulted in a 44% decrease in low-density lipoprotein (LDL) cholesterol in hypercholesterolemic rats treated with 10 microg/kg of the compound. Normal rats required a higher dose of 1000 microg/kg to elicit a similar 50% reduction in LDL cholesterol. Both CGS 23425 or T3 (10 nM) increased the specific binding of 125I-labeled LDL to Hep G2 cells and increased LDL receptor number by 44 and 49%, respectively. These data indicate that CGS 23425 enhances hepatic clearance of serum LDL cholesterol. Normal and fat-fed animals treated with the drug showed a dose-dependent increase in apolipoprotein AI, a protein that promotes the efflux of cholesterol from peripheral tissues. Transient transfection of a rat apolipoprotein AI promoter-chloramphenicol acetyltransferase construct, in human hepatoma cells, showed a dose-dependent increase in chloramphenicol acetyltransferase activity with EC50 values of 2 x 10(-12) M and 10(-10) M for thyroid hormone receptors beta1 and alpha1, respectively, with maximal responses at 10(-7) M. These data indicate that CGS 23425 is a thyromimetic that increases apolipoprotein AI expression via thyroid hormone receptor. In summary, CGS 23425 ameliorates hypercholesterolemia by increasing apolipoprotein A1 and the clearance of LDL cholesterol. Therefore, a compound like CGS 23425 may be useful for the prevention and reversal of atherosclerosis.
...
PMID:Beneficial effects of a novel thyromimetic on lipoprotein metabolism. 928 17

We examined the molecular basis by which T3 regulates the human cholesterol 7alpha-hydroxylase gene (CYP7A1) promoter. L-T3 decreased chloramphenicol acetyltransferase activity in hepatoma cells cotransfected with a plasmid encoding the T3 receptor (TR) alpha [NR1a1] and a chimeric gene containing nucleotides -372 to +61 of the human CYP7A1 gene fused to the chloramphenicol acetyltransferase structural gene. Deoxyribonuclease I footprinting revealed that recombinant TRalpha protected two regions in this segment of the human CYP7A1 gene promoter. In EMSAs, TRalpha bound to both regions. The binding was competed by oligonucleotides bearing an idealized TRalpha binding motif and abolished by mutation of these elements. In assays of promoter function, mutation of only one of the TRalpha binding sites blocked repression by T3. The results indicate that T3-dependent repression of human CYP7A1 gene expression is mediated via a novel site in the human CYP7A1 gene promoter.
...
PMID:A distinct thyroid hormone response element mediates repression of the human cholesterol 7alpha-hydroxylase (CYP7A1) gene promoter. 1177 35