Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Since cAMP has a number of important effects regulating activity of adrenergic receptor pathways, we wondered if expression of the alpha 2A adrenergic receptor gene is regulated by this second messenger. We have examined the effects of a cAMP analog (Bt2cAMP) on the expression of alpha 2A adrenergic receptors in HT-29 cells. Bt2cAMP induced a 5.3 +/- 0.8-fold increase in alpha 2A receptor mRNA abundance as did forskolin and vasoactive intestinal polypeptide which both increase cAMP accumulation in these cells. Bt2cAMP increased alpha 2A receptor number up to 2.4 +/- 0.3-fold. The rate of alpha 2A receptor gene transcription increased 7.8 +/- 3.2-fold in cells treated with Bt2cAMP for 2 h; after 24 h, the transcription rate was 3.7 +/- 1.7-fold higher than in controls. The increased rate of transcription occurred in the presence of the protein synthesis inhibitor cycloheximide. The half life of the alpha 2A receptor mRNA in cells incubated with Bt2cAMP for 2 h increased by 1.5-fold but returned to the original value after exposure to Bt2cAMP for 24 h. The increased expression of alpha 2A receptors was associated with an increased efficacy of inhibition of cAMP accumulation mediated by the alpha 2 adrenergic agonist UK14304. Using a chloramphenicol acetyltransferase (CAT) reporter plasmid containing 5'-flanking sequences of the alpha 2A receptor gene, we found that co-transfection of JEG-3 cells with expression vectors containing cAMP-dependent protein kinase regulatory subunit cDNA with mutations at both cAMP binding sites inhibited basal and Bt2cAMP-stimulated expression of CAT activity. These results demonstrate that an alpha 2A adrenergic receptor gene is regulated by the second messenger cAMP via cAMP-dependent protein kinase, mainly by controlling the rate of transcription, which leads to an increased expression of these receptors.
...
PMID:cAMP regulates transcription of the alpha 2A adrenergic receptor gene in HT-29 cells. 184 58

The tumor necrosis factor (TNF) promoter and 3'-untranslated region (3'-UTR) each contain sequence elements that mediate a response to bacterial endotoxin. Although the promoter contains sequences that permit augmented TNF gene transcription in response to LPS, the 3'-UTR contains sequences that normally confer translational repression, but which allow "derepression" to occur after cell contact with endotoxin. We now show that both genetic elements act in concert during activation of TNF gene expression in macrophages. In order to do so, we have made use of chloramphenicol acetyltransferase reporter constructs in which the TNF promoter and 3'-UTR are represented either independently or in combination with one another. Suppression of chloramphenicol acetyltransferase and TNF mRNA synthesis, observed after treatment of the macrophages with dexamethasone, 2-aminopurine, pentoxifylline, or dibutyryl cAMP, has also been studied in detail. Each class of inhibitor suppresses TNF biosynthesis through a separate mechanism. Interestingly, suppression by pentoxifylline is manifested partly (but not entirely) at the level of transcription, and depends upon the presence of both the TNF promoter and 3'-UTR. The data suggest that other sequences within the TNF gene could also be required for the full effect of pentoxifylline, which may act to prevent processing of the primary transcript. The suppressive effect of dexamethasone is manifested both at the level of transcription and at the level of translation, and is mediated both by sequences present in the TNF promoter and by sequences present in the 3'-UTR. Suppression by 2-aminopurine is solely dependent upon promoter sequences.
...
PMID:Interactive effects of the tumor necrosis factor promoter and 3'-untranslated regions. 184 73

Gonadotropins (follicle-stimulating hormone (FSH), luteinizing hormone, and human chorionic gonadotropin) and beta-adrenergic agonists have been shown to stimulate expression of the proopiomelanocortin (POMC) gene in ovarian granulosa cells. The current studies investigate the intracellular mechanisms by which gonadotropins regulate gene expression. Primary cultures of rat granulosa cells were transfected with the plasmid POMC-CAT-150, which expresses the chloramphenicol acetyltransferase (CAT) reporter gene under the regulation of the rat POMC 5'-flanking region. CAT activity was stimulated by treatment of the cells with either 20 ng/ml FSH or 1 microM isoproterenol. To assess the role of protein kinase A (ATP:protein phosphotransferase; EC 2.7.1.37) in the gonadotropin and adrenergic response, an expression vector, MtR-AB, encoding a mutant RI regulatory subunit was cotransfected with POMC-CAT-150. The mutant protein kinase A regulatory subunit encoded by MtR-AB lacks functional cAMP-binding sites but effectively binds and specifically inhibits the catalytic activity of protein kinase A. The results of this analysis demonstrated that gonadotropin and adrenergic agonist stimulation of the POMC-CAT reporter construct in primary cultures of rat granulosa cells were abolished by cotransfection with MtR-AB; whereas a control SV40-promoter construct was unaffected by either gonadotropin treatment or cotransfection with MtR-AB. Basal expression directed by the POMC promoter was also decreased by cotransfection with the MtR-AB, implying that basal expression from the POMC promoter may also depend on protein kinase A. Deletion analysis of the POMC sequence indicated regions (-40 to -33 and +4 to +63) important for basal and FSH-stimulated expression. These studies suggest that both gonadotropin and adrenergic stimulation of the POMC promoter are mediated by protein kinase A and that regions proximal to the promoter are essential for gonadotropin-regulated expression from the promoter.
...
PMID:Specific inhibition of protein kinase A in granulosa cells abolishes gonadotropin regulation of the proopiomelanocortin promoter. 190 60

Cytochrome P450c17 is the single microsomal enzyme catalyzing steroid 17 alpha-hydroxylase and 17-20-lyase activities. It is expressed and regulated by tropic hormones in the human adrenal and gonads, but is not expressed in the placenta. To study the transcriptional regulation of the human P450c17 gene, we constructed 11 plasmids containing serial deletions of its 5' nontranslated region driving expression of the chloramphenicol acetyltransferase (CAT) reporter gene. These constructs were transfected into mouse adrenal Y1 and testis MA-10 cells and incubated with forskolin, 8-bromo-cAMP, or 12-O-tetradecanoyl-phorbol-13 acetate (TPA) for 12 h. Interpretation of results from standard constructions was difficult, apparently because some transcription was incorrectly initiated by DNA sequences in the vector. Therefore, we built a modified CAT reporter vector that eliminated detectable read-through transcription. In Y1 cells, the basal activity of constructs containing from -82 to -184 basepairs (bp) of 5' flanking DNA was between 80-150% of the promoterless control. Constructs containing at least -235 bp of this DNA expressed CAT at 540% of the control value, but addition of sequences to -774 had no further effect. Forskolin increased the expression of CAT activity to 300% above basal with constructions containing DNA from -184 to -774 bp. Constructs containing between -184 and -310 bp expressed CAT at 50% of the forskolin-induced levels in cells treated with TPA. Both basal and cAMP-induced expression were much lower in MA-10 cells than in Y1 cells and increased with increasing promoter length to -774.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Tissue-specific, cyclic adenosine 3',5'-monophosphate-induced, and phorbol ester-repressed transcription from the human P450c17 promoter in mouse cells. 196 90

Transcription of the thyroglobulin (TG) gene in rat thyroid FRTL-5 cells is stimulated by two hormones, TSH and insulin-like growth factor-I (IGF-I). The effect of TSH is mimicked by cAMP. Promoter regions of the rat TG gene responsible for hormonal action as well as the nuclear regulatory proteins that interact with these regions were characterized. Minimal promoter that responds to both hormones has been found to be up to -171 basepairs from the transcription initiation site. In DNase-I footprinting analysis, nuclear extracts from cells treated with either of these hormones protected the same two major regions within the minimal promoter. Mutations in these two regions abolished basal, TSH-stimulated, as well as IGF-I-stimulated expression of the fused reporter gene chloramphenicol acetyltransferase. DNA mobility shift assay revealed that cAMP and IGF-I induce binding of similar nuclear proteins to these promoter regions. These results suggest that rat TG gene transcription is regulated by the convergent action of two distinct signaling pathways, possibly involving similar DNA-binding nuclear proteins and regulatory sequences of the TG gene promoter.
...
PMID:Similar nuclear factors mediate stimulation of rat thyroglobulin gene transcription by thyrotropin and insulin-like growth factor-I. 196 92

A bovine genomic library was constructed using a cosmid vector, pHC79, and bovine DNA partially digested by EcoRI. Bovine P-450(11 beta) cDNA, pcP-450(11 beta)-2 [Morohashi et al. (1987) J. Biochem. 102,559-568], was used as a probe for screening the genomic library. Ten clones carrying P-450(11 beta) genomic DNA were isolated from 8 x 10(4) colonies and classified into five groups (CB11 beta-1, CB11 beta-3, CB11 beta-7, CB11 beta-20, and CB11 beta-21) according to differences in the restriction endonuclease sites. Nucleotide sequences of amino acid coding regions of the five clones were determined by the dideoxy sequencing method using synthetic nucleotides corresponding to various parts of the cDNA as primers. The nucleotide sequences revealed that three clones, CB11 beta-1, CB11 beta-3, and CB11 beta-21, were pseudogenes. Amino acid sequences coded by the other two clones, CB11 beta-7 and CB11 beta-20, were identical with that coded by a previously described cDNA, pcP-450(11 beta)-3 [Kirita et al. (1988) J. Biochem. 104, 683-686]. The promoter regions of the five clones were introduced in front of chloramphenicol acetyltransferase (CAT) gene of pSV00CAT and used to examine P-450(11 beta) gene regulation in cultured cells. The five recombinant plasmids showed cAMP-responsive CAT activities in Y-1 cells, a cell strain derived from adrenal tumor. The induction rates of the recombinant plasmids carrying the promoters of normal genes, CB11 beta-7 and -20, were larger than those of pseudogenes, CB11 beta-1, -3, and -21. CAT activities expressed by the promoter regions of the normal genes in the presence or absence of cAMP in Y-1 cells were almost equal to that by the promoter region of human P-450(SCC) gene. Though the promoter of the P-450(SCC) gene also showed cAMP-responsive CAT activity in I-10 cells, a cell strain derived from Leyding cell tumor, P-450(11 beta) gene promoter did not express the activity in I-10 cells.
...
PMID:Structural analysis of multiple bovine P-450(11 beta) genes and their promoter activities. 196 87

In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11 beta) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11 beta-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at -331 bp to -324 bp in the promoter region of the P-450(11 beta) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11 beta) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11 beta) gene, and named them Ad5 and Ad6.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Novel cAMP regulatory elements in the promoter region of bovine P-450(11 beta) gene. 196 88

Deregulated c-fos expression in the rat pheochromocytoma cell line, PC-12, causes pronounced downregulation of nerve growth factor (NGF)-induced c-fos and c-jun activation, accompanied by a block in NGF-induced differentiation of PC-12 cells. The FOS-expressing PC-12 cells were exposed to diverse agents such as NGF, epidermal growth factor (EGF), basic fibroblast growth factor (bFGF), interleukin-1 beta (IL-1 beta), interleukin-6 (IL-6), dibutyryl cyclic adenosine 3',5' monophosphate (db cAMP), and Ca-ionophore; and the expression of egr-1, c-fos, c-jun, jun-B, and jun-D was analyzed. Pronounced downregulation of c-fos, c-jun, and--to a lesser extent--jun-B was observed on treatment with NGF, bFGF, db cAMP, and Ca-ionophore, whereas EGF-induced activation of these early response genes was not inhibited in FOS-expressing PC-12 cells. Ca-ionophore- and db cAMP-induced egr-1 activation in PC-12 fos cells was completely inhibited. Both parent and PC-12 fos cells expressed similar high basal levels of jun-D, whose expression was the least regulatable by all of these agents. Transfection of fos promoter-chloramphenicol acetyltransferase (promoter-CAT) plasmid into these stable FOS-expressing PC-12 cells revealed that these effects are exerted at the fos promoter level.
...
PMID:Transcriptional regulation of early growth response genes in FOS-expressing PC-12 cells. 196 43

cAMP-dependent protein kinase appears to play a role in cAMP-induced gene expression in mammalian cells. There exist two major types of cAMP-dependent protein kinase, type I and type II, which are distinguished by their regulatory subunits, RI and RII, respectively. We investigated the role of type I and type II protein kinase in the cAMP-induced gene expression by either stable or co-transfection of RI alpha, RII alpha, or RII beta gene in an expression vector together with somatostatin-chloramphenicol acetyltransferase (SS-CAT) fusion gene using a cAMP-unresponsive mutant pheochromocytoma cell line (A126-1B2). Introduction of the RII beta gene restored the capability of these cells to induce the SS-CAT gene expression in response to forskolin stimulus and induced a changed morphology which resembled that of wild type. The RII alpha gene also induced SS-CAT gene expression but to a lesser degree than that achieved by the RII beta gene, whereas the RI alpha gene had no effect. The induction of SS-CAT gene expression by the RII beta gene was specifically blocked by the 21-mer RII beta antisense oligodeoxynucleotide. These results show for the first time that type II but not type I regulatory subunit of cAMP-dependent protein kinase is essential for a cAMP-induced gene transcription.
...
PMID:Type II regulatory subunit of protein kinase restores cAMP-dependent transcription in a cAMP-unresponsive cell line. 197 35

A cAMP response element (CRE) has been identified in the proximal 5'-flanking region of the rat glucagon gene, and activation of the cAMP-dependent pathway in fetal rat intestinal cells leads to an increase in the levels of glucagon mRNA transcripts. In contrast, the human glucagon gene does not contain a similar CRE, and the results of studies using immortalized rat and hamster islet cell lines have suggested that glucagon gene expression may not be regulated by cAMP. To reconcile these observations, we have studied the control of glucagon gene expression. Incubation of primary rat islet cell cultures with forskolin in the presence of low (0.5 g/liter) or high (2.0 g/L) glucose resulted in a 2- to 3-fold increase in the levels of glucagon mRNA transcripts. Forskolin also stimulated the secretion and synthesis of immunoreactive glucagon. The importance of the protein kinase-A-dependent pathway in the regulation of glucagon gene expression was also examined in hamster islet InR1-G9 cells. Cotransfection of a glucagon-chloramphenicol acetyltransferase (CAT) fusion gene containing the glucagon CRE and a cDNA encoding the catalytic subunit of protein kinase-A resulted in stimulation of glucagon-CAT activity in hamster islet cells. Catalytic subunit cotransfection also activated somatostatin-CAT, but no activation of RSVCAT was detected. The results of these experiments suggest that the rat glucagon gene is regulated by a protein kinase-A-dependent pathway in the endocrine pancreas.
...
PMID:The rat glucagon gene is regulated by a protein kinase A-dependent pathway in pancreatic islet cells. 198 32


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>

---