Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The effects of okadaic acid (OA), a protein phosphatase inhibitor, on transcriptional enhancement activity of rat glucocorticoid receptor (GR) were examined in transiently transfected cells. In the absence of hormone, GRs expressed in CV-1 and COS-1 fibroblasts were capable of enhancing transcription from cotransfected chloramphenicol acetyltransferase reporter plasmids in response to OA treatment. Synergistic enhancement resulted from combined hormone and OA treatment. The effects of OA on GR-mediated enhancement required the presence of linked glucocorticoid response elements and were observed with reporter plasmids that contained different promoters and glucocorticoid response elements. Since OA did not affect nuclear translocation of the receptor, enhancement mediated by unliganded GR was most likely accounted for by the accumulation of some unliganded GRs within nuclei of transfected CV-1 and COS-1 cells. Deletion of individual GR transactivation domains and point mutations within DNA- and hormone-binding domains severely reduced the response of receptors to OA, although some mutant receptors retained the capacity to elicit a synergistic response when exposed to OA and hormone. The effects of OA on transcriptional enhancement did not appear to correlate with major changes in GR phosphorylation, as visualized by two-dimensional tryptic mapping of in vivo 32P-labeled GRs. Thus, phosphorylation of various components of the GR signal transduction pathway, and not necessarily the receptor itself, may influence its transcriptional enhancement activity.
...
PMID:Effects of okadaic acid, a protein phosphatase inhibitor, on glucocorticoid receptor-mediated enhancement. 131 Jul 97

Skeletal alpha-actin mRNA increases in the adult heart during cardiac hypertrophy after the imposition of hemodynamic overload/aortic restriction. 3,3',5-Triiodo-L-thyronine (T3) elicits a cardiac response similar to the effect of prolonged exercise and was recently shown to cause a rapid increase in the amount of skeletal alpha-actin mRNA in hearts from normal and hypophysectomized animals. We used transient transfection analysis to show that T3 induces the expression of the native skeletal alpha-actin promoter between nucleotide positions -2000 and +239 linked to the chloramphenicol acetyltransferase reporter gene in COS-1 fibroblasts and myogenic C2C12 cells. This T3 (10-100 nM)-induced transcriptional activation is dependent on the expression of the thyroid hormone receptors from transfected alpha 1 and beta 1 c-erbA complementary DNA expression vectors. Electrophoretic mobility shift assays were used to identify a thyroid hormone response element (TRE) in the human skeletal alpha-actin gene. This TRE is located between nucleotide positions -173 and -149 with respect to the start of transcription at +1 (5' TGGTCAACGCAGGGGACCCGGGCGG 3'). Electrophoretic mobility shift assay experiments showed that the putative skeletal alpha-actin TRE and defined rodent growth hormone TREs (that bind thyroid hormone receptors in vitro and in vivo) interacted with an identical nuclear factor in vitro in muscle cells that was developmentally regulated during myogenesis. Transient transfection analysis utilizing 5' unidirectional deletions of the skeletal alpha-actin promoter indicated that cis-acting sequences between nucleotide positions -432 and -153, which encompassed the TRE, were required for T3/thyroid hormone receptor-dependent trans-activation in vivo. Furthermore, we demonstrated that the skeletal alpha-actin TRE is juxtaposed next to SRF and SpI binding sites, at its 5' and 3' flanks, respectively. It is also surrounded by sequences densely populated by other SpI, SRF, and CTF binding sites. In conclusion, these results indicate that T3-induced increases in alpha-actin mRNA in animals are mediated by a direct transcriptional mechanism that may involve interactions with ubiquitous proteins.
...
PMID:The human skeletal alpha-actin promoter is regulated by thyroid hormone: identification of a thyroid hormone response element. 131 69

An infectious molecular clone of the TM1 strain of feline immunodeficiency virus (FIV) was transfected into each of one feline (CRFK), two simian (COS and Vero) and two human (SW480 and HeLa) non-lymphoid cell lines, and virus production was assayed on feline T lymphoblastoid MYA-1 cells by monitoring reverse transcriptase activity. Infectious virus was produced in CRFK, Vero and HeLa cells, but not in COS and SW480 cells. When the basal promoter activity of the FIV long terminal repeat (LTR) was examined in these cell lines by using a chloramphenicol acetyltransferase assay, the activity correlated with the virus production in each cell line. Furthermore, when the activity of the FIV LTR was compared with those of three primate lentivirus LTRs, the highest activity in all the cell lines examined was produced by the LTR of simian immunodeficiency virus from African green monkey (SIVAGM), suggesting that it has a wide expression range. In COS and SW480 cells, the activity of the FIV LTR was much lower than that of the SIVAGM LTR. These results indicate that, whereas the primary block to FIV infection of certain cells may occur at the cell surface, the FIV LTR may also participate in controlling virus replication, as an intracellular mechanism.
...
PMID:Production of feline immunodeficiency virus in feline and non-feline non-lymphoid cell lines by transfection of an infectious molecular clone. 131 47

Transcriptional activation of human heat shock protein (HSP) genes by heat shock or other stresses is regulated by the activation of a heat shock factor (HSF). Activated HSF posttranslationally acquires DNA-binding ability. We previously reported that quercetin and some other flavonoids inhibited the induction of HSPs in HeLa and COLO 320DM cells, derived from a human colon cancer, at the level of mRNA accumulation. In this study, we examined the effects of quercetin on the induction of HSP70 promoter-regulated chloramphenicol acetyltransferase (CAT) activity and on the binding of HSF to the heat shock element (HSE) by a gel mobility shift assay with extracts of COLO 320DM cells. Quercetin inhibited heat-induced CAT activity in COS-7 and COLO 320DM cells which were transfected with plasmids bearing the CAT gene under the control of the promoter region of the human HSP70 gene. Treatment with quercetin inhibited the binding of HSF to the HSE in whole-cell extracts activated in vivo by heat shock and in cytoplasmic extracts activated in vitro by elevated temperature or by urea. The binding of HSF activated in vitro by Nonidet P-40 was not suppressed by the addition of quercetin. The formation of the HSF-HSE complex was not inhibited when quercetin was added only during the binding reaction of HSF to the HSE after in vitro heat activation. Quercetin thus interacts with HSF and inhibits the induction of HSPs after heat shock through inhibition of HSF activation.
...
PMID:Inhibition of the activation of heat shock factor in vivo and in vitro by flavonoids. 132 38

DNA sequences required for expression of the mouse cytochrome c oxidase subunit IV (COXIV) promoter were identified by transient expression of recombinant COXIV-chloramphenicol acetyltransferase constructs in COS and NIH-3T3 cells. Activity of the COXIV promoter is shown to depend upon upstream Sp1 binding sequences and two tandemly repeated 21-base pair sequence elements each mapping to sites of mRNA initiation. Each initiation region repeat contains a binding site for an ets-related transcription factor which demonstrates specificity for the characteristic GGAA ets sequence motif and reactivity with an ets domain-directed monoclonal pan ets antibody. The two 21-base pair repeats are sufficient for transcriptional activity suggesting that the ets-related factor may be involved in both transcriptional activation and start site positioning. The ets-related protein found in COS nuclear extracts is shown to be identical or closely related to the GA-binding protein (GABP) by comparison of electrophoretic mobilities and immunological reactivities of DNA-protein complexes formed with purified recombinant expressed GABP alpha and beta subunits. Sp1 and the GABP-related factors also bind to another mouse cytochrome oxidase subunit gene COXVb. The similar promoter features of these two genes suggests a possible means of coordinate transcriptional regulation among such respiratory proteins.
...
PMID:The basal promoter elements of murine cytochrome c oxidase subunit IV gene consist of tandemly duplicated ets motifs that bind to GABP-related transcription factors. 133 Oct 86

The pregnancy-specific beta 1 glycoprotein (PSG) genes encode a group of heterogeneous proteins produced in large amounts by the human syncytiotrophoblast. Their expression seems to be regulated at the transcriptional level during normal pregnancy. In the present work, we isolated from a human placental library a 17 kb genomic fragment corresponding to a member of the PSG multigene family. DNA sequence analysis of 1190 nucleotides upstream of the translational start and of the first intron, revealed the presence of several putative regulatory sequences. In a transient chloramphenicol acetyltransferase expression assay, 5' flanking sequences within 123 nucleotides upstream to the first major transcription initiation site, functioned as a strong promoter in COS-7 cells. Meanwhile, sequences 5' further upstream had the ability to abolish this promoter activity. The sequence analyzed did not contain any obvious TATA-like boxes or G+C-rich regions, suggesting the existence of unique promoter elements implicated in transcription initiation and regulation of this PSG gene family member.
...
PMID:Nucleotide sequence of a pregnancy-specific beta 1 glycoprotein gene family member. Identification of a functional promoter region and several putative regulatory sequences. 145 58

The effects of addition of exogenous spermidine and spermine and of two inhibitors of polyamine biosynthesis, alpha-difluoromethylornithine (DFMO), which decreases spermidine concentrations, and n-butyl-1,3-diaminopropane, which depletes spermine, on the expression of S-adenosylmethionine decarboxylase (AdoMetDC) activity were studied in mammalian cell lines (HT29, CHO and COS-7). AdoMetDC levels were inversely related to the polyamine content, and spermine was the more potent repressor of AdoMetDC activity, but only spermidine affected the amount of AdoMetDC mRNA. Transfection of COS-7 cells or CHO cells with plasmid constructs containing a chloramphenicol acetyltransferase (CAT) reporter gene driven by portions of the AdoMetDC promoter region indicated that CAT expression was altered by spermidine, but not by spermine, suggesting that there is a spermidine-responsive element in this promoter. Transient transfection of COS-7 cells with pSAMh1, a plasmid containing the AdoMetDC cDNA in a vector with the SV40 promoter and origin of replication, led to a large increase in AdoMetDC expression. Although treatment of COS-7 cells with n-butyl-1,3-diaminopropane greatly increased endogenous AdoMetDC activity, the spermine depletion brought about by this inhibitor did not stimulate AdoMetDC expression from pSAMh1. The pSAMh1 cDNA is missing 72 nucleotides from the 5' end of the AdoMetDC mRNA, and it is possible that translational regulation by spermine involves this region. The expression of AdoMetDC from pSAMh1 in COS-7 cells was greatly inhibited by DFMO treatment, although endogenous AdoMetDC activity was increased. The expression of other plasmids containing the SV40 origin of replication was also inhibited by DFMO in COS-7 cells, but not in CHO cells. DFMO treatment did not interfere with the expression of plasmids driven by the RSV promoter. These results suggest that low spermidine levels interfere with the replication of plasmids containing the SV40 origin of replication.
...
PMID:Regulation of S-adenosylmethionine decarboxylase activity by alterations in the intracellular polyamine content. 146 54

N-myristoylated viral polypeptide mu 1 was produced in COS cells transfected with a transient expression vector containing a DNA copy of the reovirus M2 gene. The mu 1 product was specifically cleaved to polypeptide mu 1C in cells that were cotransfected with the reovirus S4 gene and that expressed polypeptide sigma 3. Studies with site-specific mutants of the M2 gene demonstrated that conversion of mu 1 to mu 1C was dependent on myristoylation and the presence of the proteolytic cleavage sequence asparagine 42-proline 43 in mu 1, as well as on the presence of polypeptide sigma 3. The mu 1C product and polypeptide sigma 3 formed complexes that were immunoprecipitated by sigma 3-directed antibody, and a myristoylation-negative M2 double mutant, G2A-N42T, yielded mu 1 that did not undergo cleavage to mu 1C or bind sigma 3. However, the N42T single mutant did form immunoprecipitable complexes with sigma 3, indicating that binding can occur in the absence of cleavage. Polypeptide sigma 3 alternatively can bind double-stranded RNA and in COS cells stimulates translation of reporter chloramphenicol acetyltransferase mRNA translation, presumably by blocking double-stranded RNA-mediated activation of the eukaryotic initiation factor 2 alpha subunit kinase which inhibits the initiation of protein synthesis. Consistent with these observations and with the formation of mu 1C-sigma 3 complexes, coexpression of M2 with S4 DNA prevented the translational stimulatory effect of polypeptide sigma 3.
...
PMID:Reovirus polypeptide sigma 3 and N-terminal myristoylation of polypeptide mu 1 are required for site-specific cleavage to mu 1C in transfected cells. 154 57

Inadequate androgen action in genetic and gonadal males causes an intersex phenotype. We have analyzed the androgen receptor (AR) gene in male pseudohermaphrodites with normal specific binding of dihydrotestosterone in their genital skin fibroblasts. In five patients with Reifenstein syndrome we have detected a point mutation in the DNA binding domain. They are from two unrelated families and presented with perineoscrotal hypospadias and undescended testes. After puberty they showed small testes, no palpable prostate, micropenis, azoospermia, and gynecomastia. The mutation was discovered when cDNA fragments from three brothers were sequenced. For rapid detection of the mutation in heterozygous and hemizygous carriers, allele-specific PCRs and restriction-analysis techniques have been developed. Relatives of the patients, a group of normal blood donors, and other patients were screened with these methods. Among 41 intersex patients with incomplete virilization, another two brothers presenting with this mutation were identified. The mutation is a guanine-to-adenine transition at nucleotide 2314, which changes the alanine codon (GCC) immediately after the first cysteine of the second zinc finger motif of the AR into a threonine codon (ACC). The mutation was recreated in an AR expression vector, and wild-type as well as mutant ARs were expressed in COS-7 cells. Cotransfection experiments were made using a mouse mammary tumor virus-chloramphenicol acetyltransferase reporter gene. The ability of the mutant receptor to stimulate transcription of the reporter gene was reduced by about two-thirds, as compared with the wild-type receptor.
...
PMID:Point mutation in the DNA binding domain of the androgen receptor in two families with Reifenstein syndrome. 159 12

The digestion of dietary triglycerides occurs in the duodenum through the action of triglyceride lipase, a pancreatic exocrine protein. The activity of pancreatic lipase is inhibited by the bile salts normally found in the gut lumen. Another pancreatic exocrine protein, colipase, restores the lipolytic activity of triglyceride lipase. The synthesis and secretion of both triglyceride lipase and colipase is increased by dietary fats and secretin. An increase in mRNA accompanies the increased activity, suggesting that the genes for triglyceride lipase and colipase contain nucleotide elements responsive to dietary fats or secretin or both. To study the regulation of colipase expression, we have first isolated the gene for human colipase from a cosmid library with a cDNA probe. The gene was localized to chromosome 6 and is organized into three exons contained in a single 3.3-kb BamHI fragment. The 5'-flanking region of the gene contains a TATA box, a GC box, and a 28-bp region with homology to the rat pancreatic-specific enhancer. This region directs the tissue-specific expression of the chloramphenicol acetyltransferase gene in a transfected rat pancreatic acinar cell line, AR42-J. The same construct is inactive in HEPG2, C2C12, and COS-1 cells. These results demonstrate that the isolated gene for human colipase contains tissue-specific promoter activity in the 5'-flanking DNA. The 28-bp region specifically binds to a factor in nuclear extracts.
...
PMID:The human colipase gene: isolation, chromosomal location, and tissue-specific expression. 164 46


1 2 3 4 5 6 7 8 9 10 Next >>