Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
 5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Kell is one of the major blood group systems in human erythrocytes. It is a complex system containing a large number of different antigens. Previously we cloned the Kell cDNA, which was predicted to encode an integral membrane protein with 731 amino acids. Now we have isolated overlapping genomic clones and determined the exon-intron structure of the KEL gene; it spans approximately 21.5 kb with its coding sequence being organized in 19 exons that range in size from 63 bp to 288 bp. The size of introns ranges from 93 bp to approximately 6 kb. The donor and acceptor splice sites all conform to the consensus splicing sequences. Exon 1 encodes only the initiation amino acid, methionine, and contains a consensus Sp1 binding site. The single membrane spanning region of Kell protein is encoded in exon 3 and the putative zinc endopeptidase active site is in exon 16. The amino acids encoded by the 19 exons are identical to those of a person with a common Kell phenotype, as determined by RNA polymerase chain reaction of peripheral blood. Amplification of cDNA 5' ends, derived from human fetal liver, indicated three transcription initiation sites located 30, 81, and 120 bp upstream of the initiation codon. The 5' flanking region of KEL from -176 does not contain a TATA sequence, but has possible GATA-1 binding sites and has significant promoter activity when determined by chloramphenicol acetyltransferase activity in K562 cells.
 ...
PMID:Organization of the gene encoding the human Kell blood group protein. 863 75

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.
 ...
PMID:Identification and characterization of two androgen response regions in the human neutral endopeptidase gene. 1116 97

The influenza A virus NEP (NS2) protein is an structural component of the viral particle. To investigate whether this protein has an effect on viral RNA synthesis, we examined the expression of an influenza A virus-like chloramphenicol acetyltransferase (CAT) RNA in cells synthesizing the four influenza A virus core proteins (nucleoprotein, PB1, PB2, and PA) and NEP from recombinant plasmids. Influenza A virus NEP inhibited drastically, and in a dose-dependent manner, the level of CAT expression mediated by the recombinant influenza A virus polymerase. This inhibitory effect was not observed in an analogous artificial system in which expression of a synthetic CAT RNA is mediated by the core proteins of an influenza B virus. This result ruled out the possibility that inhibition of reporter gene expression was due to a general toxic effect induced by NEP. Analysis of the virus-specific RNA species that accumulated in cells expressing the type A recombinant core proteins and NEP showed that there was an important reduction in the levels of minireplicon-derived vRNA, cRNA, and mRNA molecules. Taken together, the results obtained suggest a regulatory role for NEP during virus-specific RNA synthesis, and this finding is discussed regarding the biological implications for the virus life cycle.
 ...
PMID:Influenza A virus NEP (NS2 protein) downregulates RNA synthesis of model template RNAs. 1131 64

Nucleocytoplasmic transport of viral ribonucleoproteins (vRNPs) is an essential aspect of the replication cycle for influenza A, B, and C viruses. These viruses replicate and transcribe their genomes in the nuclei of infected cells. During the late stages of infection, vRNPs must be exported from the nucleus to the cytoplasm prior to transport to viral assembly sites on the cellular plasma membrane. Previously, we demonstrated that the influenza A virus nuclear export protein (NEP, formerly referred to as the NS2 protein) mediates the export of vRNPs. In this report, we suggest that for influenza B and C viruses the nuclear export function is also performed by the orthologous NEP proteins (formerly referred to as the NS2 protein). The influenza virus B and C NEP proteins interact in the yeast two-hybrid assay with a subset of nucleoporins and with the Crm1 nuclear export factor and can functionally replace the effector domain from the human immunodeficiency virus type 1 Rev protein. We established a plasmid transfection system for the generation of virus-like particles (VLPs) in which a functional viral RNA-like chloramphenicol acetyltransferase (CAT) gene is delivered to a new cell. VLPs generated in the absence of the influenza B virus NEP protein were unable to transfer the viral RNA-like CAT gene to a new cell. From these data, we suggest that the nuclear export of the influenza B and C vRNPs are mediated through interaction between NEP proteins and the cellular nucleocytoplasmic export machinery.
 ...
PMID:Influenza B and C virus NEP (NS2) proteins possess nuclear export activities. 1146 9