Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:2.3.1.28 (
chloramphenicol acetyltransferase
)
5,100
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
The expression of the nicotinic acetylcholine receptor (AChR) in vertebrate striated muscle is regulated both during development by nerve-evoked muscle activity and by local factors released or associated with the nerve ending. The expression pattern of AChR is achieved by coordinate regulation of four embryonic subunit mRNAs, alpha, beta, gamma and delta. We have taken the approach of identifying the similarities and differences among cis-acting regulatory elements of AChR genes to gain a better understanding of these mechanisms. Thus, to begin to define DNA sequences necessary for the transcriptional regulation of the mouse beta AChR gene, we have analyzed its 5'-flanking region. Primer extension and RNAase protection analyses showed that transcription initiates at one major and two minor sites, all of which are close to the translational initiation site. Using plasmids in which segments of the 5'-flanking region were linked to the bacterial
chloramphenicol acetyltransferase
(
CAT
) gene, we have demonstrated that 150 bp of the 5'-flanking region is active in C2 myotubes but not C2 myoblasts or NIH3T3 fibroblasts. This region contains a putative binding site for myoD, and when linked to
CAT
was transactivated by the muscle regulatory factors myoD, myogenin, and MRF4. Thus, a 150 bp sequence of the beta-subunit gene contains information necessary for developmental specificity and responsiveness to myogenic factors.
...
PMID:The 5'-flanking region of the mouse muscle nicotinic acetylcholine receptor beta subunit gene promotes expression in cultured muscle cells and is activated by MRF4, myogenin and myoD. 131 51
Signal recognition particle (SRP) induces elongation arrest of nascent presecretory proteins as the signal peptide protrudes from the large ribosomal subunit. To examine the relationship between the size of the precursor and extent of SRP mediated inhibition of polypeptide chain elongation, we performed in vitro translation experiments in the presence of SRP using a series of truncated preproinsulin mRNA molecules. These precursors possessed the same NH2 terminus as native preproinsulin followed by progressively shorter COOH termini. SRP inhibited translation of precursors as short as 64 amino acids in length, however, the extent of inhibition diminished for shorter precursors. This correlated with a reduction in the time required for ribosomes to transit through the mRNA encoding the shortened precursors. By exploiting a chimeric protein comprising the first 71 residues of preproinsulin fused to the bacterial cytoplasmic enzyme
chloramphenicol acetyltransferase
, we demonstrate that the largest size a nascent chain can reach and still be susceptible to SRP-mediated elongation arrest is approximately 17 kDa. Our data support the model that SRP binding to the signal peptide is a reversible process even in the absence of microsomal membranes, and that SRP can arrest polypeptide chain elongation at multiple stages during translation.
...
PMID:Translocation of preproinsulin across the endoplasmic reticulum membrane. The relationship between nascent polypeptide size and extent of signal recognition particle-mediated inhibition of protein synthesis. 131 69
Skeletal alpha-actin mRNA increases in the adult heart during cardiac hypertrophy after the imposition of hemodynamic overload/aortic restriction. 3,3',5-Triiodo-L-thyronine (T3) elicits a cardiac response similar to the effect of prolonged exercise and was recently shown to cause a rapid increase in the amount of skeletal alpha-actin mRNA in hearts from normal and hypophysectomized animals. We used transient transfection analysis to show that T3 induces the expression of the native skeletal alpha-actin promoter between nucleotide positions -2000 and +239 linked to the
chloramphenicol acetyltransferase
reporter gene in COS-1 fibroblasts and myogenic C2C12 cells. This T3 (10-100 nM)-induced transcriptional activation is dependent on the expression of the thyroid hormone receptors from transfected alpha 1 and beta 1 c-erbA complementary DNA expression vectors. Electrophoretic mobility shift assays were used to identify a thyroid hormone response element (TRE) in the human skeletal alpha-actin gene. This TRE is located between nucleotide positions -173 and -149 with respect to the start of transcription at +1 (5' TGGTCAACGCAGGGGACCCGGGCGG 3'). Electrophoretic mobility shift assay experiments showed that the putative skeletal alpha-actin TRE and defined rodent growth hormone TREs (that bind thyroid hormone receptors in vitro and in vivo) interacted with an identical nuclear factor in vitro in muscle cells that was developmentally regulated during myogenesis. Transient transfection analysis utilizing 5' unidirectional deletions of the skeletal alpha-actin promoter indicated that cis-acting sequences between nucleotide positions -432 and -153, which encompassed the TRE, were required for T3/thyroid hormone receptor-dependent trans-activation in vivo. Furthermore, we demonstrated that the skeletal alpha-actin TRE is juxtaposed next to SRF and SpI binding sites, at its 5' and 3' flanks, respectively. It is also surrounded by sequences densely populated by other SpI, SRF, and CTF binding sites. In conclusion, these results indicate that T3-induced increases in alpha-actin mRNA in animals are mediated by a direct transcriptional mechanism that may involve interactions with ubiquitous proteins.
...
PMID:The human skeletal alpha-actin promoter is regulated by thyroid hormone: identification of a thyroid hormone response element. 131 69
Infection by vesicular stomatitis virus (VSV) results in a rapid inhibition of host cell transcription and translation. To determine whether the viral matrix (M) protein was involved in this inhibition of host cell gene expression, an M protein expression vector was cotransfected with a target gene vector, encoding the target gene, encoding
chloramphenicol acetyltransferase
(
CAT
). Expression of M protein caused a decrease in
CAT
activity in a gene dosage-dependent manner, and inhibition was apparent by 12 h posttransfection. The inhibitory effect of M protein was quite potent. The level of M protein required for a 10-fold inhibition of
CAT
activity was less than 1% of the level of M protein produced during the sixth hour of VSV infection. Northern (RNA) analysis of cotransfected cells showed that expression of M protein caused a reduction in the steady-state level of the vector-encoded mRNAs. Expression of both
CAT
and M mRNAs was reduced in cells cotransfected with a plasmid encoding M protein, indicating that expression of small amounts of M protein from plasmid DNA inhibits further expression of both M and
CAT
mRNAs. Nuclear runoff transcription analysis demonstrated that expression of M protein inhibited transcription of the target genes. This is the first report of a viral gene product which is capable of inhibiting transcription in vivo in the absence of any other viral component.
...
PMID:Vesicular stomatitis virus matrix protein inhibits host cell-directed transcription of target genes in vivo. 131 97
The purpose of this investigation was to identify and characterize the regulatory elements involved in the transcriptional activation of the beta gamma (leaky-late or gamma 1) genes of herpes simplex virus type 1 (HSV-1) by using the major capsid protein (VP5 or ICP5) gene as model. Gel mobility shift assays with nuclear extracts from uninfected and infected HeLa cells enabled us to identify two major protein-DNA complexes involving the VP5 promoter. The mobilities of these two complexes remained unaltered, and no unique complexes were observed when infected cell nuclear extracts were used. DNase I and orthophenanthroline-Cu+ footprint analyses revealed that the two complexes involve a single binding site, GGCCATCTTGAA, located between -64 and -75 bp relative to the VP5 cap site. To determine the function of this leaky-late binding site (LBS) in VP5 gene activation, we tested the effect of mutations in this region by using transient expression of a cis-linked
chloramphenicol acetyltransferase
gene. Deletion of the above sequence resulted in a seven- to eightfold reduction in the level of transactivation of the
chloramphenicol acetyltransferase
gene by superinfection with HSV-1 or by cotransfection of HSV-1 immediate-early genes. From these results, we conclude that the LBS sequence and a cellular factor(s) are involved in the transactivation of the VP5 gene. A search of published gene sequences revealed that sequences related to the LBS exist in a number of other HSV-1, cytomegalovirus, retrovirus, and cellular promoters. Sequence homologies of binding sites and results of unpublished competition binding studies suggest that this leaky-late binding factor may be related to, or the same as, a ubiquitous cellular transcriptional factor called YY1 or common factor-1 (also known as NF-E1, delta, and UCRBP).
...
PMID:Transactivation of the major capsid protein gene of herpes simplex virus type 1 requires a cellular transcription factor. 131 6
To examine the role of nuclear retinoic acid (RA) receptors (RARs) in the regulation of squamous differentiation in normal human epidermal keratinocytes (NHEK), we analyzed binding activity, mRNA expression, and transcriptional activity of the endogenously expressed RARs. Specific RA-binding activity eluted from size-exclusion HPLC with an apparent mol wt of 50 kilodaltons and was predominantly (greater than 95%) associated with the NHEK nuclear cell fraction. This RAR-binding activity represented in part the expression of RAR alpha and RAR gamma genes, whose transcripts were expressed in similar abundance in undifferentiated NHEK. Differentiation resulted in lower mRNA expression of RAR alpha relative to the mRNA expression of RAR gamma. Treatment of NHEK cells with 10(-6) M RA did not induce expression of RAR beta mRNA. Similarly, three squamous cell carcinoma cell lines derived from human skin and oral cavity expressed RAR alpha and RAR gamma transcripts, but not RAR beta transcripts. Transfection of NHEK with
chloramphenicol acetyltransferase
(
CAT
) reporter plasmids indicated that the endogenously expressed RARs could activate transcription through the RAR beta response element in a concentration-dependent manner with doses of 10(-9) M RA and higher.
CAT
expression was not activated through TRE, a palindromic thyroid hormone response element with purported RA responsiveness. The competitive binding of benzoic acid derivatives of RA to RAR correlated with the ability of each analog to suppress mRNA expression of the squamous cell markers, involucrin, type I transglutaminase, and SQ37, and to activate transcription of the RAR beta response element-
CAT
reporter. These results demonstrate that the control of NHEK differentiation by RA is consistent with the interaction of the retinoid with RAR and the regulation of transcription by that ligand-receptor complex.
...
PMID:Retinoic acid receptors as regulators of human epidermal keratinocyte differentiation. 131 2
Human pregnancy-specific glycoproteins (PSGs) are a family of closely related placental proteins that, together with the carcinoembryonic antigen members, comprise a subfamily within the immunoglobulin superfamily. To facilitate study of the control of PSG expression, we immortalized human placental cell lines with adenovirus-origin-minus (ori-)-simian virus-40 (SV40) recombinant viruses containing either wild-type or temperature-sensitive (ts) A mutants of SV40. Cells transformed with the SV40 tsA chimera (HP-A1 and HP-A2), but not the SV40 wild-type chimera (HP-W1), were temperature sensitive for transformation. All three cell lines expressed trophoblast-specific genes, including PSG and the alpha- and beta-subunits of hCG. Human CG alpha expression was greatly stimulated by (Bu)2cAMP in all three cell lines; shifting HP-A1 and HP-A2 cells to the nonpermissive temperature (39.5 C) further increased hCG alpha expression. At both 33 C (permissive temperature) and 39.5 C, the transformed placental cells expressed PSG mRNAs of 2.2 and 1.7 kilobases; expression was greatly stimulated by sodium butyrate. In the absence of an inducer, the three placental lines synthesized a PSG of 64 kilodaltons (kDa). In the presence of butyrate, they synthesized PSGs of 72, 64, and 54 kDa, similar to the placental PSGs. However, in placenta the predominant species is the 72-kDa product. At 39.5 C, butyrate selectively increased synthesis of the 72-kDa PSG in HP-A1 and HP-A2 cells. To characterize PSG promoter activity, we constructed
chloramphenicol acetyltransferase
(
CAT
) fusion genes containing -809 to -44 basepairs up-stream of the translational start site of the PSG6 gene. Using transient expression assays, we demonstrated that the -809/-44 region of the PSG6 gene contained cis-acting sequences that can direct
CAT
expression in human placental cells. Sodium butyrate, which stimulates PSG expression, greatly increased
CAT
activity, indicating that butyrate-induced PSG expression is regulated primarily at the level of gene transcription.
...
PMID:Immortalization of virus-free human placental cells that express tissue-specific functions. 131 3
Genomic clones containing 1.7 kilobases of the 5'-flanking region of the rat TSH receptor (TSHR) plus coding sequence from the ATG initiation codon [1 basepair (bp)] to the start of the first intron (170 bp) have been isolated and characterized. RNAase protection, primer extension, and cDNA sequences cloned by the anchored polymerase chain reaction identified multiple transcriptional start sites, the major ones clustered between -89 to -68 bp. This portion of the 5'-flanking region has neither a TATA nor a CCAAT box, is GC rich but has no GC box motif, and has features of promoters seen in "housekeeping" genes. Chimeras containing 1.7 kilobases (-1707 to -2 bp) of the 5'-flanking region, or deletions thereof, and the bacterial
chloramphenicol acetyltransferase
(
CAT
) gene expressed significant
CAT
activity when transfected into rat thyroid cell lines, FRTL-5 and FRT, but not BRL rat liver or HeLa cells. TSH decreased
CAT
activity in the FRTL-5 thyroid cells that had been stably transfected with the TSHR-
CAT
chimeric constructs. Negative regulation of promoter activity by TSH was duplicated by 10 microM forskolin in FRT thyroid cells, which express no TSHR mRNA. Deletion analyses indicated that a "minimal" region, exhibiting promoter activity, tissue specificity, and negative regulation by TSH, is located between -195 and -39 bp; this region is highly conserved in rat and human TSHR genes. Differential digestion of genomic DNA by MspI and HpaII revealed that the TSHR promoter is methylated in FRT, but not FRTL-5, cells; methylation of the promoter may be associated with loss of endogenous TSHR gene expression in FRT cells.
...
PMID:Characterization of the 5'-flanking region of the rat thyrotropin receptor gene. 131 4
An infectious molecular clone of the TM1 strain of feline immunodeficiency virus (FIV) was transfected into each of one feline (CRFK), two simian (COS and Vero) and two human (SW480 and HeLa) non-lymphoid cell lines, and virus production was assayed on feline T lymphoblastoid MYA-1 cells by monitoring reverse transcriptase activity. Infectious virus was produced in CRFK, Vero and HeLa cells, but not in COS and SW480 cells. When the basal promoter activity of the FIV long terminal repeat (LTR) was examined in these cell lines by using a
chloramphenicol acetyltransferase
assay, the activity correlated with the virus production in each cell line. Furthermore, when the activity of the FIV LTR was compared with those of three primate lentivirus LTRs, the highest activity in all the cell lines examined was produced by the LTR of simian immunodeficiency virus from African green monkey (SIVAGM), suggesting that it has a wide expression range. In COS and SW480 cells, the activity of the FIV LTR was much lower than that of the SIVAGM LTR. These results indicate that, whereas the primary block to FIV infection of certain cells may occur at the cell surface, the FIV LTR may also participate in controlling virus replication, as an intracellular mechanism.
...
PMID:Production of feline immunodeficiency virus in feline and non-feline non-lymphoid cell lines by transfection of an infectious molecular clone. 131 47
Transcription of the complete mouse mammary tumor virus (MMTV) proviral genome in mouse cells is controlled by a strong promoter in its long terminal repeat. In the mouse T lymphoma EL4, there is a second, activation-dependent transcriptional initiation site within the envelope (env) gene, from which a short mRNA is generated, encoding the open reading frame of the long terminal repeat. We now report the isolation of a segment of the MMTV env gene (called META, for MMTV env transcriptional activator) which has the expected transcription-activating properties seen in EL4.E1 cells. Namely, it induces activation-dependent, T-lymphocyte-specific transcription of a
chloramphenicol acetyltransferase
reporter gene. It is active in mouse or human T-helper lymphocyte lines when they are stimulated to transcribe lymphokine genes but is inactive in unstimulated T-helper cells, fibroblasts, a cytotoxic T-lymphocyte line, and a mastocytoma cell line. Its activity is inhibited by cyclosporin A, a specific inhibitor of lymphokine transcription. Several forms of the META have been isolated from EL4.E1 cells, a mouse T-helper cell hybridoma, and from BALB/c spleen cells. Linked to the heterologous thymidine kinase promoter, a 400-bp portion of it is an inducible, orientation-independent, and cyclosporin A-sensitive transcriptional activator in T-helper cells.
...
PMID:An activation-dependent, T-lymphocyte-specific transcriptional activator in the mouse mammary tumor virus env gene. 132 Jan 98
<< Previous
1
2
3
4
5
6
7
8
9
10
Next >>