Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:2.3.1.28 (
chloramphenicol acetyltransferase
)
5,100
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Fibrates have been reported to modulate plasma high density lipoprotein cholesterol and apolipoprotein (apo) A-I concentrations. Therefore, the molecular mechanisms underlying the regulation of human apoA-I gene expression by fibrates was investigated. Fenofibrate reduced the expression of a reporter gene driven by the DNA sequences between -192 and +91 (BC-P-
chloramphenicol acetyltransferase
; CAT) relative to the apoA-I gene transcription start site approximately 3-fold. The sequences involved in the down-regulation of apoA-I gene transcription by fenofibrate were localized between -41 and +91 (P-CAT) relative to the transcription start site. The reduction of the expression of BC-P-CAT was dose-dependent and maximal at 500 microM (20 +/- 7%). Different peroxisome proliferators showed different levels of repression varying from 39 +/- 4% for fenofibrate, 43 +/- 5% for tetradecylthioacetic acid, 48 +/- 4% for bezafibrate, 54 +/- 2% for 5,8,11,14-eicotetraynoic acid, 76 +/- 2% for ciprofibrate, whereas Wy 14643 only marginally inhibited the expression of BC-P-CAT. By contrast, inclusion of sequences between -256 and -192 (ABC-P-CAT) attenuated the repression by fenofibrate. Furthermore, the apoA-IA site (-214 to -192; Awt-P-CAT) could counteract the repression of P-CAT by fenofibrate in the presence of cotransfected mPPAR alpha (peroxisome proliferator-activated receptor). In addition, the acyl-CoA oxidase-peroxisome proliferator response element (PPRE) could substitute the wild-type A-site in blocking the fenofibrate-induced reduction of the apoA-I promoter by mPPAR alpha. The protective effect of
PPAR
on fenofibrate induced inhibition of apoA-I expression was abolished after mutation of the direct repeat in the A site (Am-P-CAT). Consistent with these functional data only the wild-type, but not the mutated A site bound
PPAR
/retinoic X receptor heterodimers in gel shift assays. These data suggest that certain peroxisome proliferators can reduce the expression of the apoA-I promoter in a
PPAR
-independent fashion, through modulation of factors interacting with sequences localized between -41 and +91 of the apoA-I gene transcription initiation site. This inhibitory effect can be overcome when
PPAR
interacts with a functional PPRE, such as the apoA-I A site or the acyl-CoA oxidase-PPRE.
...
PMID:Negative regulation of the human apolipoprotein A-I promoter by fibrates can be attenuated by the interaction of the peroxisome proliferator-activated receptor with its response element. 798 38
The aromatic fatty acid phenylacetate and its analogs induce tumor cytostasis and differentiation in experimental models. Although the underlying mechanisms of action are not clear, effects on lipid metabolism are evident. We have now examined whether these compounds, structurally similar to the peroxisome proliferator clofibrate, affect the human peroxisome proliferator-activated receptor (hPPAR), a homolog of the rodent
PPAR
alpha, a transcriptional factor regulating lipid metabolism and cell growth. Gene transfer experiments showed activation of hPPAR, evident by the increased expression of the reporter gene
chloramphenicol acetyltransferase
linked to
PPAR
-response element from either the rat acyl-CoA oxidase or rabbit CYP4A6 genes. The relative potency of tested drugs in the co-transfection assay was: 4-iodophenylbutyrate > 4-chlorophenylbutyrate > clofibrate > phenylbutyrate > naphthylacetate > 2,4-D > 4-chlorophenylacetate > phenylacetate >> indoleacetate. Phenylacetylglutamine, in which the carboxylic acid is blocked, was inactive. The ability of the aromatic fatty acids to activate
PPAR
was confirmed in vivo, as CYP4A mRNA levels increased in hepatocytes of treated rats. Further studies using human prostate carcinoma, melanoma, and glioblastoma cell lines showed a tight correlation between drug-induced cytostasis, increased expression of the endogenous hPPAR, and receptor activation documented in the gene-transfer model. These results identify phenylacetate and its analogs as a new class of aromatic fatty acids capable of activating hPPAR, and suggest that this nuclear receptor may mediate tumor cytostasis induced by these drugs.
...
PMID:Activation of a human peroxisome proliferator-activated receptor by the antitumor agent phenylacetate and its analogs. 875 39
A human genomic clone containing a 5.9 kb promoter region of the human pyruvate dehydrogenase (E1) alpha subunit gene (PDHA1) was isolated from a human X-chromosome library. The nucleotide sequence showed two Alu repeats at the -2880 and -2200 bp regions. Comparison between the -1400 bp E1alpha promoter and the -1241 bp E1beta promoter revealed a 57% homology, with a high degree of homology at the putative protein binding regions in these two promoters. Computer-aided transcription factor binding consensus sequence analysis revealed the presence of
PPAR
, HOXD, MyoD and other tissue-specific transcription factor binding sites. Promoter function analysis using the
chloramphenicol acetyltransferase
reporter gene indicated that the -2.2 kb/-1.7 kb and -5.9 kb/-5.2 kb regions of the E1alpha promoter may possess negative regulatory elements which are likely to function in a tissue-specific manner.
...
PMID:Cloning and characterization of a 5.9 kb promoter region of the human pyruvate dehydrogenase alpha subunit gene. 1035 Jun 29
Adipocyte amino acid transporter (AAAT) is induced during the 3T3-L1 preadipocyte differentiation process. In the -1819-bp 5'-upstream flanking region of the AAAT genomic gene, six DNase I protected sites were identified by using the 3T3-L1 adipocyte nuclear extract. Results of
chloramphenicol acetyltransferase
(
CAT
) expression from the chimeric AAAT promoter-driven
CAT
reporter gene indicated that one protein binding site, from -68 to -26, was essential for the promoter activity. However, this protein binding site does not contain recognition sites of the transcription factors important for adipocyte differentiation, i.e., the C/EBP or
PPAR
family. Further analysis revealed that the DNA sequence, TTCAAGTCCCGCCCTCCGCT from -65 to -46, was the cis-element essential and partially sufficient for inducible activity of the AAAT gene promoter.
...
PMID:An SP1-like cis-element is the major DNA motif for differential expression regulation of the adipocyte amino acid transporter. 1077 87