Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
 5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

We have used a transient expression assay in aleurone protoplasts of barley to delineate hormone response elements of the abscisic acid (ABA)-responsive rice gene Rab16A and of the gibberellin A3 (GA3)-responsive barley alpha-amylase gene Amy 1/6-4. Our approach used transcriptional fusions between their 5' upstream sequences and a bacterial chloramphenicol acetyltransferase reporter gene. A chimeric promoter containing six copies of the -181 to -171 region of Rab 16A fused to a minimal promoter conferred ABA-responsive expression on the reporter gene. Transcription from this ABA response element (GTACGTGGCGC) was unaffected by GA3. A chimeric promoter containing six copies of the -148 to -128 sequence of Amy 1/6-4 fused to the minimal promoter conferred GA3-responsive expression on the reporter gene. Transcription from this GA3 response element (GGCCGATAACAAACTCCGGCC) was repressed by ABA. The effect on transcription from both hormone response elements was orientation-independent, indicating that they function as inducible enhancers in their native genes.
 ...
PMID:cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid. 183 Dec 69

The amyR2 allele of the Bacillus subtilis alpha-amylase cis-regulatory region enhances production of amylase and transcription of amyE, the structural gene, by two- to threefold over amyR1. The amylase gene bearing each of these alleles was cloned on plasmids of about 10 to 15 copies per chromosome. Transcription of the cloned amylase gene by each amyR allele was activated at the end of exponential growth and was subject to catabolite repression by glucose. The amount of amylase produced was roughly proportional to the copy number of the plasmid, and cells containing the amyR2-bearing plasmid, pAR2, produced two- to threefold more amylase than cells with the amyR1 plasmid, pAMY10. Deletion of DNA 5' to the alpha-amylase promoter, including deletion of the A + T-rich inverted repeat found in amyR1 and amyR2, had no effect on expression or transcription of alpha-amylase. Deletion of DNA 3' to the amyR1 promoter did not impair temporal activation of chloramphenicol acetyltransferase in amyR1-cat-86 transcriptional fusions, but catabolite repression was abolished. When an 8-base-pair linker was inserted in pAMY10 at the same site from which the 3' deletion was made, amylase expression doubled and was repressed less by glucose. Both the deletion and the insertion disrupted four bases at the 3' end of the putative amylase operator region. Site-directed mutagenesis was used to change bases in the promoter-operator region of amyR1 to their amyR2 counterparts. Either change alone increased amylase production twofold, but only the change at +7, next to the linker insertion of 3' deletion site, yielded the increased amylase activity in the presence of glucose that is characteristic of the amyR2 strain. The double mutant behaved most like strains carrying the amyR2 allele.
 ...
PMID:Genetic analysis of the promoter region of the Bacillus subtilis alpha-amylase gene. 250 Apr 16

Three cis-acting alleles (gra-10, gra-5, and amyR2) of the Bacillus subtilis amyR promoter locus each cause catabolite repression-resistance of amyE-encoded alpha-amylase synthesis. The gra-10, gra-5, and amyR2 alleles were transferred from the chromosomes of their respective hosts to a plasmid carrying the amyR1-amyE+ gene by the process of gene conversion which is carried out during transformation of competent B. subtilis by plasmid clones carrying homologous DNA. The cloned amyR promoter regions containing the gra-10 and gra-5 mutations were shown to confer catabolite repression-resistance in cis to the synthesis of chloramphenicol acetyltransferase encoded by the cat-86 indicator gene when subcloned into the promoter-probe plasmid pPL603B. Implications concerning both the regulation of amyR utilization and the process of gene conversion in B. subtilis are discussed.
 ...
PMID:Molecular cloning of cis-acting regulatory alleles of the Bacillus subtilis amyR region by using gene conversion transformation. 308 88

Bacillus subtilis 168GR10 was shown to contain a mutation, gra-10, which allowed normal temporal activation of alpha-amylase synthesis in the presence of a concentration of glucose that is inhibitory to activation of amylase synthesis in the parent strain, 168. The gra-10 mutation was mapped by phage PBS-1-mediated transduction and by transformation to a site between lin-2 and aroI906, very tightly linked to amyE, the alpha-amylase structural gene. The gra-10 mutation did not pleiotropically affect catabolite repression of sporulation or of the synthesis of extracellular proteases or RNase and was unable to confer glucose-resistance to the synthesis of chloramphenicol acetyltransferase encoded by the cat-86 gene driven by the amyE promoter region (amyR1) inserted into the promoter-probe plasmid pPL603B. It therefore appears that gra-10 defines a cis-regulatory site for catabolite repression, but not for temporal activation, of amyE expression. The evidence shows that temporal activation and glucose-mediated repression of alpha-amylase synthesis in B. subtilis 168 are distinct phenomena that can be separated by mutation.
 ...
PMID:Isolation and characterization of a cis-acting mutation conferring catabolite repression resistance to alpha-amylase synthesis in Bacillus subtilis. 391 91

Intracellular pH (pHi) of barley aleurone cells is known to be affected by hormones and plant growth conditions. The possible mechanisms by which these pHi shifts influence the actions of abscisic acid (ABA) or gibberellin (GA) is being investigated. Here we report an attempt to study the effect of pHi on hormone-induced gene expression. We used weak acids and weak bases to artificially mimic the pHi changes brought about by ABA and GA and found that chloramphenicol acetyltransferase (CAT) expression controlled by the Rab promoter was affected while the alpha-amylase promoter seemed insensitive. CAT fused to the 35S promoter was used as a control which is not inducible by ABA or GA3. The expression of this construct was not significantly affected by artificial pHi changes.
 ...
PMID:The effect of intracellular pH on the regulation of the Rab 16A and the alpha-amylase 1/6-4 promoter by abscisic acid and gibberellia. 772 58

We constructed a novel cloning system with positive selection for inserted fragments. The gene for tetracycline resistance (tetR) originally used in plasmid pTR262 was replaced with the gene for chloramphenicol acetyltransferase (cat) and terminator sequences were introduced downstream of the cat gene. The terminator sequences stop transcription originating on strong PR promoter that would otherwise proceed through the region of replication origin and interfere with plasmid replication. Thus the copy number of recombinant plasmid molecules is stabilized. The cloning system has been constructed in a new YEp type shuttle vector, pPW264. The 8.1 kb-vector carries two unique cloning sites, BglII and HindIII. The maintenance of the vector and selection in yeast is ensured by URA3 Saccharomyces cerevisiae gene. The vector was employed in cloning of the gene for alpha-amylase from Schwanniomyces occidentalis.
 ...
PMID:Direct selection shuttle plasmid vector, pPW264, used for cloning the alpha-amylase gene of Schwanniomyces occidentalis. 772 61

Here, we report on the construction of three integrative plasmids for Bacillus subtilis (Bs) allowing in vitro construction of transcriptional fusions. These plasmids contain a neomycin- or tetracycline-resistance cassette and one of three promoterless genes: bgaB (encoding beta-galactosidase), cat (chloramphenicol acetyltransferase), or xylE (catechol 2,3-dioxygenase). All cassettes are flanked by the 3'- and 5'-ends of the amyE gene (encoding alpha-amylase) allowing integration of these cassettes at the amyE locus of the Bs chromosome. For propagation and selection in Escherichia coli, the plasmids contain the pBR322 origin of DNA replication and the beta-lactamase-encoding bla gene. Four unique restriction sites can be used for insertion of restriction fragments carrying promoter fragments. All three reporter genes express heat-stable enzymes (stable up to at least 50 degrees C for 30 min) as shown here. We would like to point to the modular nature of these plasmids where the three reporter genes and the two resistance cassettes can be combined in any permutation. The versatility of the promoter-probe vectors was demonstrated by the integration of the promoters of the dnaK and groE operons of Bs and following their heat-inducible expression.
 ...
PMID:Integrative vectors for constructing single-copy transcriptional fusions between Bacillus subtilis promoters and various reporter genes encoding heat-stable enzymes. 898 64

The xylose cluster of Lactobacillus pentosus consists of five genes, two of which, xylAB, form an operon and code for the enzymes involved in the catabolism of xylose, while a third encodes a regulatory protein, XylR. By introduction of a multicopy plasmid carrying the xyl operator and by disruption of the chromosomal xylR gene, it was shown that L. pentosus xylR encodes a repressor. Constitutive expression of xylAB in the xylR mutant is repressed by glucose, indicating that glucose repression does not require XylR. The xylR mutant displayed a prolonged lag phase compared to wild-type bacteria when bacteria were shifted from glucose to xylose medium. Differences in the growth rate in xylose medium at different stages of growth are not correlated with differences in levels of xylAB transcription in L. pentosus wild-type or xylR mutant bacteria but are positively correlated in Lactobacillus casei with a plasmid containing xylAB. Glucose repression was further investigated with a ccpA mutant. An 875-bp internal fragment of the ccpA gene of L. pentosus was isolated by PCR and used to construct a ccpA knockout mutant. Transcription analysis of L. pentosus xylA showed that CcpA is involved in glucose repression. CcpA was also shown to be involved in glucose repression of the alpha-amylase promoter of Lactobacillus amylovorus by demonstrating that glucose repression of the chloramphenicol acetyltransferase gene under control of the alpha-amylase promoter is strongly reduced in the L. pentosus ccpA mutant strain.
 ...
PMID:Regulation of expression of the Lactobacillus pentosus xylAB operon. 928 92