Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:2.3.1.28 (
chloramphenicol acetyltransferase
)
5,100
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Skeletal alpha-actin mRNA increases in the adult heart during cardiac hypertrophy after the imposition of hemodynamic overload/aortic restriction. 3,3',5-Triiodo-L-thyronine (T3) elicits a cardiac response similar to the effect of prolonged exercise and was recently shown to cause a rapid increase in the amount of skeletal alpha-actin mRNA in hearts from normal and hypophysectomized animals. We used transient transfection analysis to show that T3 induces the expression of the native skeletal alpha-actin promoter between nucleotide positions -2000 and +239 linked to the
chloramphenicol acetyltransferase
reporter gene in COS-1 fibroblasts and myogenic C2C12 cells. This T3 (10-100 nM)-induced transcriptional activation is dependent on the expression of the thyroid hormone receptors from transfected alpha 1 and beta 1 c-erbA complementary DNA expression vectors. Electrophoretic mobility shift assays were used to identify a thyroid hormone response element (TRE) in the human skeletal alpha-actin gene. This TRE is located between nucleotide positions -173 and -149 with respect to the start of transcription at +1 (5' TGGTCAACGCAGGGGACCCGGGCGG 3'). Electrophoretic mobility shift assay experiments showed that the putative skeletal alpha-actin TRE and defined rodent growth hormone TREs (that bind thyroid hormone receptors in vitro and in vivo) interacted with an identical nuclear factor in vitro in muscle cells that was developmentally regulated during myogenesis. Transient transfection analysis utilizing 5' unidirectional deletions of the skeletal alpha-actin promoter indicated that cis-acting sequences between nucleotide positions -432 and -153, which encompassed the TRE, were required for T3/
thyroid hormone receptor
-dependent trans-activation in vivo. Furthermore, we demonstrated that the skeletal alpha-actin TRE is juxtaposed next to SRF and SpI binding sites, at its 5' and 3' flanks, respectively. It is also surrounded by sequences densely populated by other SpI, SRF, and CTF binding sites. In conclusion, these results indicate that T3-induced increases in alpha-actin mRNA in animals are mediated by a direct transcriptional mechanism that may involve interactions with ubiquitous proteins.
...
PMID:The human skeletal alpha-actin promoter is regulated by thyroid hormone: identification of a thyroid hormone response element. 131 69
The glucocorticoid receptor is a member of the steroid and
thyroid hormone receptor
superfamily and acts as a ligand-activated transcription factor. To reconstitute the molecular mechanisms underlying the cellular response to soluble receptor ligands, we have exploited a cell-free system that exhibits glucocorticoid-induced activation of the latent cytosolic glucocorticoid receptor to an active DNA-binding species. We demonstrate here that cytosol from a rat hepatoma cell, M1.19, contains glucocorticoid receptor-specific immunoreactivities and target DNA-binding activities. Moreover, specific DNA-binding activities of M1.19 cytosol were dose-dependently induced by dexamethasone treatment, and linearly correlated with the hormonal induction of
chloramphenicol acetyltransferase
activity at the corresponding concentrations. These results indicate that the cytosolic glucocorticoid receptor could be converted in a DNA-binding form under cell-free conditions and the ligand appears to play a crucial role in the direct control of the level of functional activity of a given ligand-receptor complex.
...
PMID:In vitro monitoring activation by the ligands and specific DNA-binding of the glucocorticoid receptors. 147 88
Multiple forms of human thyroid hormone (T3) receptor have been identified, including true receptors that bind T3 (alpha 1 and beta) and a splicing variant (alpha 2) that does not bind T3. The alpha 1- and beta-receptors activate transcription through interactions with positive thyroid response elements (TREs). The alpha 2 variant is unable to activate transcription and has been reported to inhibit alpha 1 or beta stimulation of positive TREs, a property referred to as dominant negative activity. In this report we have performed studies to assess the functional properties of different members of the thyroid receptor family with regard to both positive and negative transcriptional regulation. The alpha 1-, alpha 2-, and beta-receptors were each coexpressed in JEG-3 cells with either TreTKCAT (CAT =
chloramphenicol acetyltransferase
), a reporter gene that contains a positive TRE, or TSH alpha CAT, a negatively regulated reporter gene. The alpha 1 and beta isoforms stimulated transcription of TreTKCAT and inhibited TSH alpha CAT transcription in a T3-dependent manner, whereas the alpha 2 variant was inactive. When coexpressed with alpha 1- or beta-receptors, alpha 2 inhibited regulation of positive TREs, but the effects of alpha 2 were modest and only occurred when relatively high doses of receptor were transfected. The alpha 2-receptor variant did not affect negative regulation by alpha 1- or beta-receptors. Thus, in both positive and negative regulation,
thyroid hormone receptor
isoforms that bind T3 (alpha 1, beta) are functional, whereas the alpha 2 isoform, which does not bind T3, is not functional.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Negative and positive transcriptional regulation by thyroid hormone receptor isoforms. 228
An important physiological control of the glycoprotein hormone alpha-subunit is the negative feedback by thyroid hormones in the thyrotrope. A region of the rat glycoprotein hormone alpha-subunit gene that is involved in transcriptional regulation by thyroid hormone has been identified by transient transfection studies, and sequence-specific binding of the
thyroid hormone receptor
to a site within this region has been demonstrated. Deletion-mutation studies using plasmid expression vectors containing either 246, 170, or 80 base pairs of the 5'-flanking region of the rat alpha-subunit gene fused to the coding region of the bacterial
chloramphenicol acetyltransferase
gene demonstrate 3,5,3'-triiodo-L-thyronine (T3)-regulated expression in GH3 cells, a T3-responsive somatotrophic cell line. In order to investigate the possibility of
thyroid hormone receptor
interaction with this segment of the rat alpha-subunit gene, the binding of the
thyroid hormone receptor
to synthetic oligodeoxynucleotides was analyzed using an avidin-biotin complex DNA binding assay. An oligodeoxyribonucleotide representing a fragment of the alpha-subunit gene from -74 to -38, relative to the transcriptional start site, shows significant binding to [125I]T3-receptor complex present in nuclear extracts of GH3 cells. This fragment binds receptor to a degree similar to that seen with a fragment of the rat growth hormone gene which contains a putative thyroid hormone-responsive element. In addition, this fragment of the rat alpha-subunit gene binds to the in vitro synthesized human c-erbA beta protein, which has been identified as a member of the family of putative T3 receptors. These data demonstrate that a cis-active thyroid hormone-responsive element resides in the 5'-flanking region of the rat alpha-subunit gene and that the mechanism involved in the suppression of expression of this gene by T3 could involve specific binding of the
thyroid hormone receptor
to this region of the gene.
...
PMID:Thyroid hormone regulation of the rat glycoprotein hormone alpha-subunit gene promoter activity. 246 63
The
thyroid hormone receptor
exerts transcriptional control over a variety of genes. This report describes four sites that bind this receptor with high affinity within the 5'-flanking DNA of the rat growth hormone gene, approximately centered at -180, -160, -60 and -20 nucleotides from the transcription start site. These sites were defined by gel retardation of short synthetic oligonucleotides using native receptor purified several hundred-fold from rat liver. Binding sites were also defined by methylation interference and methidium-propyl-EDTA footprinting. Alignment of the four binding sites suggests that each contains two purine-rich regions, the more downstream of which, GGGATCGC, is highly conserved. Mutations made within each of the two upstream sites reduce receptor binding affinity. For one mutation, a partial loss of receptor binding strength correlated with a change in electrophoretic mobility, indicating that receptor binding may alter DNA conformation. Mutations at each of the four sites also reduce thyroid hormone responsiveness of the -237/+11 promoter linked to the
chloramphenicol acetyltransferase
gene coding sequences and transfected into cultured pituitary (GC) cells. These results suggest that several different receptor-binding elements interact to control thyroid hormone responsiveness of the rat growth hormone gene and reveal common sequences that may be important for receptor-DNA recognition.
...
PMID:The rat growth hormone gene contains multiple thyroid response elements. 274 28
Thyroid hormone regulation of the human thyrotropin beta-subunit gene (TSH beta) was examined in a human embryonal cell line (293). Transient expression studies were performed with chimeric plasmids containing the reporter gene,
chloramphenicol acetyltransferase
. Sequences in the first exon between +9 and +37 base pairs (bp) enhanced gene expression from the human TSH beta promoter in the absence of thyroid hormone as well as mediated a concentration-dependent triiodothyronine (L-T3) decrease in gene expression. Thyroid hormone inhibition of expression was also conferred to the herpes simplex virus thymidine kinase promoter by inserting +3 to +37 bp of the human TSH beta gene downstream from the start of transcription. Primer extension analysis of RNA from transfected cell cultures revealed accurate transcription initiation in only those constructs which contained sequences between +9 and +37 bp. Moreover, RNA analysis confirmed that L-T3 inhibition of
chloramphenicol acetyltransferase
activity from chimeric pTSH beta CAT constructs occurred at a pretranslational level. In addition, a nuclear
thyroid hormone receptor
, c-erbA-beta, bound to this region in an avidin-biotin DNA binding assay. These data suggest that L-T3, bound to its receptor, may inhibit human TSH beta expression by interfering with an element that functions to enhance gene expression.
...
PMID:Thyroid hormone inhibition of human thyrotropin beta-subunit gene expression is mediated by a cis-acting element located in the first exon. 276 33
We have extensively characterized the sequences of the rat growth hormone (rGH) promoter required for induction by T3 (thyroid hormone, 3,5,3'-L-triiodothyronine) in a transient transfection system. Oligonucleotides containing portions of the rGH promoter sequence with various deletions and point mutations were placed upstream of the first 137 base pairs of the rGH promoter or the heterologous herpes virus thymidine kinase promoter in
chloramphenicol acetyltransferase
expression vectors. The rGH137 and thymidine kinase promoters show no or minimal response to T3 in the basal state. The constructs were tested in GH4C1 rat pituitary cells and COS cells (functionally deficient in
thyroid hormone receptor
) with and without a co-transfected plasmid expressing a beta type c-erbA gene coding for a functional T3 receptor. Oligonucleotides containing the T3 receptor binding site confer hormone-dependent induction in a manner that is independent of either orientation or variation in position on the helix relative to the promoter. Point mutations in the sequence -189 to -173 result in loss of T3 induction, and bases between -173 and -167 were also required for a full T3 response. The minimal length to confer T3 induction to the rGH promoter was 23 base pairs (-190 to -167). Point mutations creating a perfect duplication of 7 base pairs within the receptor binding site conferred 12-fold T3 response to the rGH137 promoter, 3-fold greater than the wild type rGH237 construct. T3 inductibility was also transferred to the thymidine kinase promoter by an oligonucleotide containing the sequence -200 to -157, demonstrating that cell type specific elements located 3' to 157 of the rGH promoter are not required for thyroid hormone responsiveness.
...
PMID:Functional characterization of the rat growth hormone promoter elements required for induction by thyroid hormone with and without a co-transfected beta type thyroid hormone receptor. 290 14
3,5,3,'-Triiodothyroacetic acid (Triac) has been used in therapy of resistance to thyroid hormone on an empirical basis and appears beneficial in some studies. We observed that the T3 analogs, Triac and 3,5,3'-triiodothyropropionic acid (Triprop), have a higher affinity for the
thyroid hormone receptor
-beta 1 (TR beta 1) than does T3 (2.7- and 1.8-fold, respectively), whereas the affinities of the three compounds for TR alpha 1 are the same. To evaluate whether T3 analogs would have a differential effect on TR beta 1 and TR beta 1 mutants and thus be a specific treatment for patients with resistance to thyroid hormone, we examined the induction of the transcriptional activation of wild-type (wt) TR alpha 1, TR beta 1, and mutant TR beta 1s by T3, Triac, and Triprop. The dose response of transcriptional activation by T3 analogs was measured by transient cotransfections with TRs and a rat malic enzyme-TRE fused to thymidine kinase (TK)-
chloramphenicol acetyltransferase
(
CAT
) in COS-1 cells. For TR alpha 1 wt, induction of
CAT
activity by T3 and Triac occurred at the same concentration. For TR beta 1 wt, Triac and Triprop showed a higher maximal activity than T3 (Tripro > Triac > T3) and reached 50% induction at a lower concentration than T3 (Tripro < Triac < T3). Induction of
CAT
activity in five mutant TR beta 1s (kindreds Mh, Mc, CL, Mf, and GH) was also analyzed. Even high levels of T3 analogs could not restore
CAT
activity to that of TR beta 1wt for any mutant. A dominant negative effect was produced by Mh, Mc, and Mf. Mutants CL and GH had a mild dominant negative effect depending on T3 analog concentrations and TREs. Cotransfection studies were performed using a rat malic enzyme-TK-
CAT
reporter plasmid to analyze the effects of hormones at near-physiological concentrations of T3 and Triac. Triac had a significantly higher transcriptional activation than T3 in Mc, CL, and GH, suggesting that Triac would have a beneficial effect to different degrees for different mutant TR beta 1s. Using mutants Mc and GH, further studies were carried out using rat GH and double palindromic and inverted palindromic TREs in COS-1 cells. On each TRE, 10 nmol/L Triac induced higher transcriptional activation in TR beta 1wt, mutant TR beta 1s, and TR beta 1wt plus mutant TR beta 1s (1:1 ratio) than the same dose of T3.(ABSTRACT TRUNCATED AT 400 WORDS)
...
PMID:Triiodothyroacetic acid has unique potential for therapy of resistance to thyroid hormone. 760 51
We have examined mechanisms of regulation of the human glycoprotein hormone alpha subunit gene by thyroid hormone (T3) and estradiol. Pituitary-derived GH3 cells were transiently transfected with chimeric constructs comprising between 1,500 and 98 base pairs of human alpha subunit gene 5'-flanking sequence fused to the bacterial gene encoding
chloramphenicol acetyltransferase
(h alpha CAT) and treated with T3 and estradiol, alone and in combination. In pituitary cells, 98 base pairs of alpha gene 5'-flanking sequence were sufficient to mediate both inhibition of alpha gene promoter activity by T3 and stimulation by estradiol; inhibition of the alpha promoter by T3 was antagonized by estradiol. Mutation of nucleotides essential for T3 receptor binding to the alpha gene thyroid hormone response element abolished the response of h alpha CAT expression to estradiol as well as T3. In contrast to pituitary GH3 cells, estradiol treatment alone had no effect on expression of either h alpha CAT or the endogenous alpha gene in JEG-3 choriocarcinoma cells cotransfected with a human
thyroid hormone receptor
expression vector, but estradiol antagonized suppression of both endogenous and transfected alpha promoter activity by T3. Gel mobility shift assays demonstrated specific binding of in vitro synthesized human estrogen receptor (ER) to the alpha gene thyroid hormone response element. These findings suggest that estradiol modulates expression of the human alpha subunit gene in pituitary and choriocarcinoma cells by direct binding of ER to the alpha gene promoter, and that interaction of ER with the alpha gene negative TRE accounts for the antagonistic effects of estradiol and T3.
...
PMID:Estradiol modulates thyroid hormone regulation of the human glycoprotein hormone alpha subunit gene. 769 20
Transcription of both Xenopus
thyroid hormone receptor
(TR) genes, xTR alpha and -beta, is strongly up-regulated by their own ligand T3 during natural or T3-induced metamorphosis of tadpoles and in some Xenopus cell lines. To explain this autoinduction, we analyzed the sequence of 1.6 kilobases of xTR beta promoter for putative T3-responsive elements. Two direct repeat +4 AGGTCA hexamer motifs (DR+4), an imperfect distal (-793/-778) and a perfect proximal (-5/11) site, a DR+1 site, and some possible half-sites were located in the 1.6-kilobase promoter. Transfection of Xenopus XTC-2 cells (which express xTR alpha and -beta) and XL-2 cells (which predominantly express TR alpha) with
chloramphenicol acetyltransferase
reporter constructs of deletion mutants and promoter fragments showed that the distal and proximal DR+4 sites responded to T3, although other flanking sequences may also play a role. The thyroid hormone-responsive element half-site present as DR+1 in the up-stream sequence at -1260/-950, when cloned in front of a heterologous promoter, functions independently. T3 enhanced transcription from the two DR+4-containing fragments when present together by only 2- to 3-fold due to a high basal activity. Overexpression of unliganded xTR alpha and xTR beta in XTC-2 cells repressed basal activity, which was then enhanced 7- to 4-fold by T3, respectively; with XL-2 cells cotransfected with xTR beta, T3 inducibility increased to 16-fold. Electrophoretic mobility shift assays with recombinant Xenopus TR alpha, TR beta, retinoid-X receptor-alpha (RXR alpha) and RXR gamma proteins showed that TR-RXR heterodimers, but not TR or RXR monomers or homodimers, strongly bound the natural and synthetic distal and proximal DR+4 elements in a ligand-independent manner. TR/RXR heterodimers exhibited the highest binding affinity for a 28-mer oligonucleotide probe for the -5/11 proximal DR+4 site, with only slight binding to DR+1 (retinoid-X-responsive element-like) site. The xTR beta promoter binding to XTC-2 cell nuclear extract suggested the in vivo relevance of the findings with recombinant TR/RXR heterodimers. It is concluded that xTR alpha and -beta proteins are capable of regulating the expression of xTR beta gene, which can explain its autoinduction seen during T3-induced metamorphosis.
...
PMID:Analysis of structure and expression of the Xenopus thyroid hormone receptor-beta gene to explain its autoinduction. 776 Aug 54
1
2
3
Next >>