Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Norethisterone (NET) and levonorgestrel (LNG) are synthetic progestins used as contragestational agents. Both compounds are biotransformed at target tissues into A-ring reduced metabolites which possess different pharmacological properties. The aim of this study was to determine the molecular mechanisms of the progestational and antiprogestational effects of NET, LNG and their metabolites by using a highly efficient, sensitive in vitro molecular assay based on the detection of a reporter gene expression (the bacterial chloramphenicol acetyltransferase (CAT) inserted downstream of a minimal promoter containing two progesterone responsive elements (PRE2) and the TATA box. For this purpose we used CV-1 monkey kidney cells, which do not possess steroid receptors. These cells were cotransfected with a progesterone receptor expression vector and the reporter vector PRE2-TATA-CAT. Data obtained using this model showed that NET and LNG induced CAT activity in a manner similar to that of the potent progestin R5020. NET and LNG metabolites exhibited a weak progestational activity; however, when 5 alpha-NET metabolite was simultaneously administered with R5020, a clear antiprogestational effect similar to that of the antiprogestin RU486 was observed. Therefore, the results clearly demonstrate that the use of the reporter CAT vector containing hormone responsive elements is a suitable assay for the screening and evaluation of new synthetic steroids with agonist or antagonist progestational activities in transfected CV-1 cell line.
...
PMID:In vitro molecular assessment of the mechanisms of action of 19-nor progestins used as contragestational agents. 884 51

The role of transforming growth factor-beta1 (TGFbeta1) in the regulation of estrogen receptor (ER) expression in MCF-7 cells was investigated. After treatment of the cells with 100 pM TGFbeta1, ER protein declined by about 30% at 6 h from a concentration of 413.5 fmol/mg protein in control cells to 289.5 fmol/mg protein in treated cells. The concentration of receptor remained suppressed for 24 h. Scatchard analysis demonstrated that the decrease in ER protein corresponded to a decrease in estradiol-binding sites, with no effect on the binding affinity of the ER. The dissociation constant of the estradiol-ER complex was 0.117 nM in TGFbeta1-treated cells compared to 0.155 nM in control cells. Treatment with TGFbeta1 did not influence the half-life of the ER. In TGFbeta1-treated cells, as well as in control cells, the half-life of the receptor was approximately 4 h. In contrast to the effect on ER concentration, TGFbeta1 treatment resulted in a greater decrease in the steady state level of ER messenger RNA (approximately 75%) at 6 h. By 24 h, a small recovery in the amount of messenger RNA was observed. Transcription run-on experiments demonstrated a decrease of approximately 70% in the level of ER gene transcription at 3 h. Transient transfections using an ER promoter-chloramphenicol acetyltransferase construct demonstrated that after TGFbeta1 treatment, chloramphenicol acetyltransferase activity decreased by 50%, suggesting that TGFbeta1 inhibition of the ER gene transcription is mediated through the ER promoter. Although treatment with TGFbeta1 decreased the ER concentration, the growth factor had no effect on the activity of ER, as measured by its effects on estradiol induction of progesterone receptor and pS2, suggesting that TGFbeta1 does not inhibit proliferation of MCF-7 cells by blocking ER activity.
...
PMID:The role of transforming growth factor-beta in the regulation of estrogen receptor expression in the MCF-7 breast cancer cell line. 907 8

The murine multidrug resistance gene mdr1b is highly induced in the endometrium during pregnancy. Evidence suggests that induction occurs mainly as a result of progesterone action. To study the molecular mechanisms involved in this induction, 5'-flanking sequences between -540 and +97 of the mdr1b gene were fused to the reporter gene, bacterial chloramphenicol acetyltransferase (p540CAT). Unlike most progesterone-responsive genes, mdr1b is preferentially activated by the A form of the progesterone receptor. We now report that activation is not observed with a DNA-binding domain mutant of progesterone receptor A (PRA) suggesting that induction occurs at the transcriptional level. Time course experiments demonstrated that induction was first observed 12 hr after hormone addition, suggestive of a secondary (or late) response gene. Sequence comparison highlighted the region M1 (-234 to -206), which contains a partially conserved progesterone response element. Its functional significance was evaluated by expression assays and gel shift analysis. Reporter plasmids with modifications of this element were transfected into HeLa cells. Constructs containing the native M1 element, or a mutated element (M1mt) that eliminated any similarity to a progesterone response element, were induced four-fold by progesterone whereas an element containing a consensus progesterone response element (M1PRE) was induced eight-fold. In addition, by gel shift analysis, the M1 element did not bind the progesterone receptor or any other factors. This suggested that the M1 region does not participate in the response to progesterone. 5' Nested deletion analysis, used to identify other regions of the upstream regulatory region that contributed to induction by progesterone, demonstrated that enhancer sequences between -122 and -65, which contain binding sites for C/EBPbeta and NF-Y, were important. Mutations in the binding sites for these factors decreased induction by progesterone. On the basis of our studies using 540 bp of upstream sequence, mdr1b is activated transcriptionally by progesterone, in an indirect manner dependent on basal factors.
...
PMID:Transcriptional regulation of the murine multidrug resistance gene mdr1b by progesterone occurs via an indirect mechanism. 926 Sep 24

Hormone response elements (HREs) are considered enhancers, activating transcription in a relatively position- and orientation-independent fashion. Upon binding to an HRE, steroid receptors presumably contact coactivators and/or proteins associated with the transcription initiation complex. As a receptor target site is moved further from a fixed position such as the TATA box, not only will the spatial separation of the receptor with respect to its interaction partners change, so will the orientation due to the rotation of the DNA helix. Additional constraints may be imposed by the assembly of DNA into chromatin. Therefore, we have endeavored to test rigorously the assertion that HRE action is position independent. We have constructed a series of 42 chloramphenicol acetyltransferase expression vectors that contain a single progesterone/glucocorticoid receptor-binding site separated from a TATA box by 4 to 286 bp. The enhancer activity of the HRE was assessed after transient transfection of progesterone receptor-expressing fibroblasts. We find that the position of the HRE has a dramatic influence on induction by progestins. When closely juxtaposed to the TATA box, the HRE was unable to support a hormone response, perhaps due to direct steric hindrance with the transcription initiation complex. Full activity was gained by moving the HRE 10 bp further from the TATA sequence. As the HRE was moved incrementally further, activity remained near maximal over the next 26 bp. HRE activity then declined over the subsequent 26 bp and remained low for another 2.5 helical turns. Surprisingly, a narrow window of HRE activity occurred at an HRE-TATA box separation of 90-100 bp. Little or no hormone-induced transcriptional activity was observed when the HRE was positioned further from the TATA box. The addition of a second HRE or a basal (nuclear factor-1) element failed to relieve this constraint. A similar series of experiments was carried out in a mammary carcinoma cell line that expressed high levels of both glucocorticoid and progestin receptors. Data in these cells indicate that glucocorticoids and progestins supported a similar HRE position-activity profile, but this pattern of HRE activity was quite distinct from that seen in fibroblasts. This may be indicative of cell type-specific interactions between steroid receptors and adapter/coactivator proteins or cell type-specific activities such as acetylases or deacetylases participating in the steroid response.
...
PMID:Extreme position dependence of a canonical hormone response element. 962 64

We have examined the human androgen receptor (hAR) for its ability to activate AR-dependent transcription of a transgene in a ligand-independent manner. The transcriptional activity was determined by analysis of chloramphenicol acetyltransferase (CAT) activity in T47D cells cotransfected with a plasmid expressing the hAR and a natural AR-regulated promoter (the MVDP androgen-dependent enhancer) ligated to the reporter CAT gene. In this study, the effects of the protein kinase C (PKC) activator 12-O-tetradecanoyphorbol-13 acetate (TPA) on AR activity were tested. We demonstrated that in the absence of androgen, TPA enhanced AR-mediated transactivation by 10-12-fold. This effect was specific of the PKC pathway since stimulation to the PKA pathway did not activate the unliganded AR. This ligand-independent pathway can function through another androgen-regulated promoter as shown by the use of the mouse mammary tumor virus MMTV-CAT reporter. The human glucocorticoid receptor (hGR) and the rabbit progesterone receptor (rPR) could not be activated by TPA, indicating that the effects are not universal for steroid receptors. A reporter plasmid containing the MVDP androgen response element (ARE) in front of the thymidine kinase promoter ligated to the CAT gene was activated by DHT but not by TPA, indicating that the context of the natural promoter is critical for ligand-independent activation of the AR. Exogenous c-jun enhanced transcriptional activation by the AR in a ligand-dependent manner, but had no effect in the absence of DHT. Base pair substitutions in both AR-binding (5'-TGTTCT-3' to 5'-TTTTTT-3') and NF1-binding (5'-GTGGCTG-3' to 5'-GTTTTTG-3') sites resulted in a loss of TPA responsiveness. Our results suggest that ligand-independent activation of the AR by TPA results from interaction of unliganded AR with other proteins in the transcription machinery.
...
PMID:Phorbol ester causes ligand-independent activation of the androgen receptor. 978 Feb 30

Glucosidase I initiates the processing of asparagine (N-) linked glycoproteins by removing the distal alpha1,2-linked glucosyl residue of the tetradecasaccharide Glc(3)Man(9)GlcNAc(2). The gene encoding this enzyme was isolated and its structural organization and promoter activity determined. The major transcript for glucosidase I on northern blot appeared to be 3.1 kb; Southern blotting and DNA sequencing indicated the size of the gene to be 6.8 kb, comprising four exons separated by three introns. The first exon encodes the cytoplasmic tail and transmembrane domain; the fourth encodes the putative catalytic domain of the enzyme. Exon-intron junctions are flanked by consensus splice donor and acceptor sequences. Transcription initiation sites were mapped by primer extension, ribonuclease protection assay and RT-PCR analysis. Primer extension results showed multiple initiation sites at -150, -156, and -272 bp relative to the translation initiation codon ATG. Sequence analysis of 5' flanking region showed no canonical TATA box, a high GC content, Sp1 and ETF binding sites (typical of a housekeeping gene promoter). Also noteworthy, the promoter region contains several generic STAT factor binding sites, one nearly perfect, and two half GR binding elements. Other cis- acting elements recognized by transcription factors such as AP-2, NF-kappaB, estrogen receptor, and progesterone receptor (PR) were also present in the putative promoter region. To determine the promoter activity, a construct encompassing the region between -2114 to -5 bp of the putative promoter was ligated to the chloramphenicol acetyltransferase (CAT) reporter plasmid and transiently transfected into COS 7 cells. CAT assay results clearly show transcriptional activity of the promoter.
...
PMID:Genomic organization and promoter activity of glucosidase I gene. 1040 45

Ishikawa endometrial cancer cells express the estrogen receptor (ER), and this study investigates aryl hydrocarbon receptor (AhR) expression and inhibitory AhR-ER crosstalk in this cell line. Treatment of Ishikawa cells with the AhR agonist [3H]2,3,7, 8-tetrachlorodibenzo-p-dioxin (TCDD) gave a radiolabeled nuclear complex that sedimented at 6.0 S in sucrose density gradients, and Western blot analysis confirmed that Ishikawa cells expressed human AhR and AhR nuclear translocator (Arnt) proteins. Treatment of Ishikawa cells with 10 nM TCDD induced a 9.7-fold increase in CYP1A1-dependent ethoxyresorufin O-deethylase (EROD) activity and a 10.5-fold increase in chloramphenicol acetyltransferase (CAT) activity in cells transfected with pRNH11c containing an Ah-responsive human CYP1A1 gene promoter insert (-1142 to +2434). Inhibitory AhR-ER crosstalk was investigated in Ishikawa cells using E2-induced cell proliferation and transcriptional activation assays in cells transfected with E2-responsive constructs containing promoter inserts from the progesterone receptor and vitellogenin A2 genes. AhR agonists including TCDD, benzo[a]pyrene (BaP) and 6-methyl-1,3,8-trichlorodibenzofuran, inhibited 32-47% of the E2-induced responses. In contrast, neither estrogen nor progesterone inhibited EROD activity induced by TCDD in Ishikawa cells, whereas inhibitory ER-AhR crosstalk was observed in ECC-1 endometrial cells suggesting that these interactions were cell context-dependent.
...
PMID:Estrogen and aryl hydrocarbon receptor expression and crosstalk in human Ishikawa endometrial cancer cells. 1082 9

To determine whether arsenite has estrogen-like activities, the effects of this compound on estrogen receptor-alpha (ERalpha) and other estrogen-regulated genes were measured in the human breast cancer cell line MCF-7. Treatment of cells with 1 microM arsenite resulted in a 60% decrease in the amount of ERalpha and in a parallel decrease of 40% in ERalpha messenger RNA. Progesterone receptor concentration increased 22-fold after arsenite treatment. pS2 messenger RNA also increased 2. 1-fold after treatment. The induction of progesterone receptor and pS2 was blocked by the antiestrogen ICI-182,780. In transient cotransfection experiments of wild-type ERalpha and an estrogen response element-reporter construct, arsenite stimulated chloramphenicol acetyltransferase (CAT) activity. In growth assays, arsenite significantly stimulated the proliferation of MCF-7 cells compared with cells grown in estrogen-depleted medium. Addition of an antiestrogen blocked growth stimulation by arsenite. In binding assays, arsenite blocked the binding of estradiol to ERalpha (Ki = 5 +/- 0.5 nM; n = 3), suggesting that the compound interacts with the hormone-binding domain of the receptor. To determine whether interaction of arsenite with the hormone-binding domain results in receptor activation, COS-1 cells were transiently cotransfected with the chimeric receptors GAL-ER, which contains the hormone-binding domain of ERalpha and the DNA-binding domain of the transcription factor GAL4, and a GAL4-responsive CAT reporter gene. Treatment of cells with estradiol or arsenite resulted in a 4-fold increase in CAT activity. The effects of arsenite on the chimeric receptor were blocked by the antiestrogen, suggesting that arsenite activates ERalpha through an interaction with the hormone-binding domain of the receptor. Transfection assays with ERalpha mutants identified C381, C447, H524, and N532 as interaction sites of arsenite with the hormone-binding domain.
...
PMID:Effects of arsenite on estrogen receptor-alpha expression and activity in MCF-7 breast cancer cells. 1101 13

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.
...
PMID:Identification and characterization of two androgen response regions in the human neutral endopeptidase gene. 1116 97

This laboratory is studying hormonal regulation of tumor suppressor proteins, p53 and retinoblastoma (pRB). Estrogen receptor and progesterone receptor positive human breast cancer cell lines, T47D and MCF-7, were utilized for determining influence of hormonal and antihormonal agents on the level of expression of p53, state of phosphorylation of pRB, and rate of cell proliferation. The expression of p53 in T47D cells grown for 4-5 days in culture medium containing charcoal-treated (stripped) fetal bovine serum declined gradually to 10% of the level seen in control (whole serum, non charcoal-treated) groups. Supplementation of culture medium containing stripped serum with 0.1-1 nM estradiol (E(2)) restored p53 to its level seen in the control within 6-24 h. Under above conditions, treatment of cells with R5020 or RU486 reduced (15-30%) the level of p53. Incubation of cells in E(2)-containing growth medium caused cell proliferation and hyperphosphorylation of pRB; the latter effect was seen maximally between 24-72 h. The E(2)-induced hyperphosphorylation of pRB and increase in the level of p53 were sensitive to the presence of ICI and 4-hydroxy tamoxifen (OHT). T47D and MCF-7 cells were also transiently transfected with a P1CAT reporter plasmid containing c-Myc responsive element and the levels of chloramphenicol acetyltransferase (CAT) activity were observed in response to various treatments. E(2) and OHT caused P1CAT induction as seen by increased CAT activity: E(2) caused an endogenous increase in the expression of an ICI-sensitive c-Myc form. These data suggest that estrogen upregulates p53 expression while progesterone downregulates this process. Further, E(2) regulates p53 level and pRB activity in a coordinated manner.
...
PMID:Hormonal regulation of tumor suppressor proteins in breast cancer cells. 1138 68


<< Previous 1 2 3 4 Next >>