Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

A monomeric androgen responsive element (ARE) is not sufficient to mediate significant androgen induction of the prostate-specific antigen (PSA) gene. Co-transfection experiments using a series of 5'deletion fragments of the proximal promoter region of the PSA gene linked to bacterial chloramphenicol acetyltransferase (CAT) as a reporter have identified two motif sequences which are indispensable for androgen receptor (AR)-mediated transactivation of the PSA promoter and have been designated as motifs A and B respectively. Of note, motif B alone has very little independent enhancer activity regardless of the presence or absence of androgen, whereas multi-copies of motif A exert androgenic inducibility for a heterologous promoter independent of the presence of ARE. Nucleotide substitutions in either motif significantly decrease the androgen inducibility and the nuclear protein binding ability. Furthermore, gel band shift experiments consistently demonstrate that nuclear proteins can bind these motifs, and they are non-receptor factors. Our data indicate that these two DNA motifs are novel cis -regulatory elements and exhibit different mechanisms in cooperation with ARE for AR-mediated transactivation.
...
PMID:Identification of two novel cis-elements in the promoter of the prostate-specific antigen gene that are required to enhance androgen receptor-mediated transactivation. 922 17

Androgens have significant beneficial effects on the skeleton. However, studies on the effects of androgens on osteoblasts are limited due to the absence of appropriate model systems that combine completeness of the osteoblastic phenotype, rapid proliferation rate, and stable expression of the androgen receptor (AR). Thus, we stably transfected the conditionally immortalized human fetal osteoblastic cell line (hFOB) with the human wild-type AR (hAR) cDNA. Compared to nontransfected hFOB cells, constitutive hAR mRNA expression in three independent hAR-transfected hFOB clones (hFOB/AR) was 15-fold higher in hFOB/AR-16, 62-fold higher in hFOB/AR-2, and 72-fold higher in hFOB/AR-6 cells, respectively, as assessed by semiquantitative reverse transcriptase-polymerase chain reaction (RT-PCR). Detectable constitutive levels of hAR mRNA by Northern blot analysis were present in hFOB/AR-2 and hFOB/AR-6 cells, but not in hFOB/AR-16 or hFOB cells, respectively. Treatment with 5 alpha-dihydrotestosterone (5 alpha-DHT) (10(-8) M) for 24 h did not alter hAR mRNA steady state levels in the hFOB/AR cell lines. Nuclear binding studies demonstrated 152 +/- 73 (mean +/- SEM) functional hARs/nucleus in non-transfected hFOB cells, 3,940 +/- 395 functional hARs/nucleus in hFOB/AR-2 cells, and 3,987 +/- 823 hARs/nucleus in hFOB/AR-6 cells, respectively. Treatment with 5 alpha-DHT increased the expression of a transiently transfected androgen response element-chloramphenicol acetyltransferase (ARE-CAT) reporter construct in hFOB/AR-6 cells in a dose- and time-dependent manner; no such effect was observed in transiently transfected hFOB cells lacking exogenously transfected hARs. Moreover, 5 alpha-DHT-induced ARE-CAT expression was inhibited by the selective androgen receptor antagonist, hydroxyflutamide. In summary, we have developed and characterized androgen-responsive osteoblastic cell lines derived from normal human fetal bone that express physiological levels of functional hARs. These cell lines should provide a suitable model for further studies on the effects of androgens on osteoblast function, including the identification of potential androgen-regulated growth factors and cytokines.
...
PMID:Development and characterization of a conditionally immortalized human osteoblastic cell line stably transfected with the human androgen receptor gene. 928 32

Age-dependent loss of androgen sensitivity of the rat liver is associated with a marked increase in dehydroepiandrosterone/hydroxysteroid sulfotransferase (rStd) activity. Sulfonated steroid hormones are known to be ineffective in binding receptor proteins. These observations suggest that intracellular androgen sulfonation can physiologically influence androgen action. We have examined the inhibitory effect of rStd on androgen action in the human prostate cancer-derived PC-3 cells transfected with the rat androgen receptor (AR) expression plasmid and two androgen-responsive promoter reporter constructs (murine mammary tumor long-terminal repeat ligated to chloramphenicol acetyltransferase (CAT) gene and rat probasin androgen response element (ARE) ligated to firefly luciferase (LUC) gene). These transfected cells were dependent on 5alpha-dihydrotestosterone (DHT) for the activation of both reporter genes and showed about a 200- and a 800-fold increase of CAT and LUC activity, respectively, at 10(-10) M DHT over the no-hormone control. Expression of the sulfonating enzyme in this cell transfection system via the rStd expression plasmid caused a dose-dependent decline in the reporter activity with approximately 90% inhibition of androgen action at a rStd:AR plasmid ratio of 100. From these results we conclude that irrespective of a high level of AR, changes in the Std expression can markedly alter the androgen sensitivity of target cells.
...
PMID:Inhibition of androgen action by dehydroepiandrosterone sulfotransferase transfected in PC-3 prostate cancer cells. 956 51

Although hormone therapy with antiandrogens has been widely used for the treatment of prostate cancer, some antiandrogens may act as androgen receptor (AR) agonists that may result in antiandrogen withdrawal syndrome. The molecular mechanism of this agonist response, however, remains unclear. Using mammalian two-hybrid assay, we report that antiandrogens, hydroxyflutamide, bicalutamide (casodex), cyproterone acetate, and RU58841, and other compounds such as genistein and RU486, can promote the interaction between AR and its coactivator, ARA70, in a dose-dependent manner. The chloramphenicol acetyltransferase assay further demonstrates that these antiandrogens and related compounds significantly enhance the AR transcriptional activity by cotransfection of AR and ARA70 in a 1:3 ratio into human prostate cancer DU145 cells. Our results suggest that the agonist activity of antiandrogens might occur with the proper interaction of AR and ARA70 in DU145 cells. These findings may provide a good model to develop better antiandrogens without agonist activity.
...
PMID:Promotion of agonist activity of antiandrogens by the androgen receptor coactivator, ARA70, in human prostate cancer DU145 cells. 963 57

We have examined the human androgen receptor (hAR) for its ability to activate AR-dependent transcription of a transgene in a ligand-independent manner. The transcriptional activity was determined by analysis of chloramphenicol acetyltransferase (CAT) activity in T47D cells cotransfected with a plasmid expressing the hAR and a natural AR-regulated promoter (the MVDP androgen-dependent enhancer) ligated to the reporter CAT gene. In this study, the effects of the protein kinase C (PKC) activator 12-O-tetradecanoyphorbol-13 acetate (TPA) on AR activity were tested. We demonstrated that in the absence of androgen, TPA enhanced AR-mediated transactivation by 10-12-fold. This effect was specific of the PKC pathway since stimulation to the PKA pathway did not activate the unliganded AR. This ligand-independent pathway can function through another androgen-regulated promoter as shown by the use of the mouse mammary tumor virus MMTV-CAT reporter. The human glucocorticoid receptor (hGR) and the rabbit progesterone receptor (rPR) could not be activated by TPA, indicating that the effects are not universal for steroid receptors. A reporter plasmid containing the MVDP androgen response element (ARE) in front of the thymidine kinase promoter ligated to the CAT gene was activated by DHT but not by TPA, indicating that the context of the natural promoter is critical for ligand-independent activation of the AR. Exogenous c-jun enhanced transcriptional activation by the AR in a ligand-dependent manner, but had no effect in the absence of DHT. Base pair substitutions in both AR-binding (5'-TGTTCT-3' to 5'-TTTTTT-3') and NF1-binding (5'-GTGGCTG-3' to 5'-GTTTTTG-3') sites resulted in a loss of TPA responsiveness. Our results suggest that ligand-independent activation of the AR by TPA results from interaction of unliganded AR with other proteins in the transcription machinery.
...
PMID:Phorbol ester causes ligand-independent activation of the androgen receptor. 978 Feb 30

For many years it has been recognized that sex steroids have profound effects on bone metabolism. The current perception is that estrogen decreases bone resorption and androgen increases bone deposition. To investigate the potential for androgens to directly modulate bone resorption, we have examined avian osteoclast and human and mouse osteoclast-like cells for androgen responsiveness. There was a dose-dependent decrease in resorption activity in response to alpha-dihydrotestosterone (alpha-DHT), beta-DHT, testosterone, or the synthetic androgen RU1881. This decrease was blocked by cotreatment with the specific androgen antagonist hydroxyflutamide. Further examination of avian osteoclasts revealed that the cells exhibited specific and saturable nuclear binding of tritiated RU1881 and that alpha-DHT stimulated the activity of the androgen response element as measured by using a chloramphenicol acetyltransferase reporter plasmid. In addition, avian osteoclasts responded to androgen treatment with elevated production and secretion of transforming growth factor beta, a well documented response to androgen exposure in other cell systems. Treatment with either alpha-DHT or beta-DHT for 24 hours resulted in a significant dose-dependent decrease in secretion of cathepsin B and tartrate-resistant acid phosphatase. This response to beta-DHT, a stereoisomer of alpha-DHT that is inactive in other androgen receptor-dependent systems, supports the hypothesis that the osteoclast androgen receptor has unusual ligand-binding properties. Taken together, these results confirm the presence of functional androgen receptors in these cells and support the conclusion that osteoclasts are able to respond directly to androgens in vitro and thus are potential androgen target cells in vivo.
...
PMID:Androgens regulate bone resorption activity of isolated osteoclasts in vitro. 989 63

Glucocorticoid and androgen receptors have been shown to function through the same palindromic glucocorticoid response element (GRE) and yet have differential effects on gene transcription. In this study, we examined the functional and structural relationship of the androgen and glucocorticoid receptors with the androgen responsive region (ARR) of the probasin (PB) gene containing two androgen receptor binding sites, ARBS-1 and ARBS-2. Transfection studies indicated that one copy of each cis-acting DNA element was essential for maximal androgen-induced chloramphenicol acetyltransferase (CAT) activity and that androgen selectivity was maintained when multiple copies of the minimal wild type (wt) androgen responsive region containing both ARBS-1 and ARBS-2 (-244 to -96) were subcloned in front of the thymidine kinase promoter. Furthermore, replacing the androgen response region with 1, 2 or 3 copies of either ARBS-1 or ARBS-2 restored less than 4% of the biological activity seen with the wt PB ARR. Multiple copies of either ARBS-1 or ARBS-2 did not result in glucocorticoid-induced CAT gene activity. By comparison, 1 or 2 copies of the tyrosine aminotransferase (TAT) GRE, as well as the mouse mammary tumour virus GRE, were strong inducers of CAT activity in response to both androgen and glucocorticoid treatment. In addition, band shift assays demonstrated that although the synthetic glucocorticoid receptor, GR-DNA binding domain (GR-DBD), and the synthetic androgen receptor, AR2, could interact with the TAT GRE (dissociation constants Kd of 63.9 and 14.1 respectively), only AR2 but not GR-DBD binding could be detected on ARBS-1 and ARBS-2. Our findings provide further evidence that androgen-induced regulation of gene transcription can occur through androgen-specific DNA binding sites that are distinct from the common GRE.
...
PMID:Selective activation of the probasin androgen-responsive region by steroid hormones. 1034 90

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.
...
PMID:Identification and characterization of two androgen response regions in the human neutral endopeptidase gene. 1116 97

The androgen receptor (AR) is a member of the steroid receptor superfamily that binds to the androgen response element to regulate target gene transcription. AR may need to interact with some selected coregulators for maximal or proper androgen function. Here we report the isolation of a new AR coregulator with a calculated molecular mass of 267 kDa named the androgen receptor-associated protein 267-alpha (ARA267-alpha). ARA267-alpha contains 2427 amino acids, including one Su(var)3-9, Enhancer-of-zeste, and Trithorax (SET) domain, two LXXLL motifs, three nuclear translocation signal (NLS) sequences, and four plant homeodomain (PHD) finger domains. Northern blot analyses reveal that ARA267-alpha is expressed predominantly in the lymph node as 13- and 10-kilobase transcripts. HepG2 is the only cell line tested that does not express ARA267-alpha. Yeast two-hybrid and glutathione S-transferase pull-down assays show that both the N and C terminus of ARA267-alpha interact with the AR DNA- and ligand-binding domains. Unlike other coregulators, such as CBP, which enhance the interaction between the N and C terminus of AR, we found that ARA267-alpha had little influence on the interaction between the N and C terminus of AR. Luciferase and chloramphenicol acetyltransferase assays show that ARA267-alpha can enhance AR transactivation in a dihydrotestosterone-dependent manner in PC-3 and H1299 cells. ARA267-alpha can also enhance AR transactivation with other coregulators, such as ARA24 or PCAF, a histone acetylase, in an additive manner. Together, our data demonstrate that ARA267-alpha is a new AR coregulator containing the SET domain with an exceptionally large molecular mass that can enhance AR transactivation in prostate cancer cells.
...
PMID:Identification and characterization of a novel androgen receptor coregulator ARA267-alpha in prostate cancer cells. 1150 67

We studied the effects of 17beta-estradiol, progesterone, and dihydrotestosterone on in vitro growth of human metastatic melanoma. Each sex hormone inhibited the growth of melanoma receptor-dependently; 17beta-estradiol inhibited 3H-thymidine uptake of estrogen receptor-positive WM266-4 and NM26, but not that of the receptor-negative HS15. Progesterone inhibited 3H-thymidine uptake of progesterone receptor-positive WM266-4 and HS15, but not that of the receptor-negative NM26. Dihydrotestosterone inhibited 3H-thymidine uptake of androgen receptor-positive HS15 and NM26, but not that of the receptor-negative WM266-4. The growth inhibition by each hormone was counteracted by the respective hormone receptor antagonist. The combination of more than two hormones neither gave additive nor synergistic growth inhibition. The growth inhibition by each sex hormone was counteracted by interleukin-8 but not by the other growth factors. Each sex hormone reduced the constitutive interleukin-8 secretion and mRNA levels in the respective receptor-positive melanoma but not in the receptor-negative melanoma. Transient transfection showed that each sex hormone inhibited the constitutive chloramphenicol acetyltransferase expression driven by interleukin-8 promoter in the respective receptor-positive melanoma but not in the receptor-negative melanoma. Transfection with a series of 5'-deleted interleukin-8 promoter/chloramphenicol acetyltransferase reporter constructs demonstrated that the sequences between -98 and -63 bp on interleukin-8 promoter may be involved in the transcriptional repression. These data suggest that 17beta-estradiol, progesterone, and dihydrotestosterone suppress the growth of melanoma by inhibiting interleukin-8 production in a receptor-dependent manner.
...
PMID:17beta-estradiol, progesterone, and dihydrotestosterone suppress the growth of human melanoma by inhibiting interleukin-8 production. 1151 5


<< Previous 1 2 3 4 5 6 Next >>