Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The rat UDP glucuronosyltransferase, UGT2B1, is expressed in the liver where it glucuronidates steroids, environmental toxins, and carcinogens. A region between -88 and -111 base pairs upstream from the UGT2B1 gene transcription start site contains a CCAAT enhancer binding protein (C/EBP)-like element and was previously shown by Dnase I footprint analysis to bind to proteins in both rat liver and human hepatoma (HepG2) cell nuclear extracts. In this study, the importance of this region in the regulation of the UGT2B1 gene was assessed by functional and DNA binding assays. Varying lengths of the UGT2B1 gene promoter, with and without the C/EBP-like element, were fused to the chloramphenicol acetyltransferase reporter gene and transfected into HepG2 cells. Transcriptional activity of the UGT2B1 promoter construct containing the C/EBP-like element was strongly elevated in the presence of a cotransfected C/EBPalpha expression vector. In contrast, no change was observed when an expression vector encoding C/EBPbeta was cotransfected with the UGT2B1 promoter constructs. Introduction of point mutations into the C/EBP-like element prevented any C/EBPalpha-mediated increase in chloramphenicol acetyltransferase activity. Gel shift analyses demonstrated that the C/EBP-like element binds a complex of nuclear proteins present in both HepG2 cells and rat liver. The presence of C/EBPalpha in this complex was confirmed by supershift analysis with antiserum to this factor. These data strongly suggest that the liver-enriched factor C/EBPalpha binds to, and activates, the UGT2B1 gene promoter. The importance of C/EBPalpha in the regulation of the homologous mouse UGT2B1 gene was also assessed in vivo. Transcripts homologous to UGT2B1 were detected in the livers of mice containing intact c/ebpalpha and c/ebpbeta genes and in mice containing a homozygous null mutation in the c/ebpbeta gene. In contrast, these transcripts were not detected in mice with a disrupted hepatic c/ebpalpha gene. These data extend the findings with the rat UGT2B1 gene promoter and establish that C/EBPalpha, but not C/EBPbeta, is an essential transcriptional regulator of the homologous UGT2B1 gene in the mouse.
...
PMID:C/EBPalpha is a regulator of the UDP glucuronosyltransferase UGT2B1 gene. 961 4

The liver-specific expression of the GLUT2 glucose transporter gene is suppressed in cultured hepatoma cell lines as well as in hepatocytes in primary culture. To understand the underlying mechanism involved in this process, we analysed the rat GLUT2 promoter region. A DNase I footprinting assay with rat liver nuclear extract revealed eight protected regions within a -500 bp region of the GLUT2 promoter (sites A to H). Three of these sites (B, F and H) were occupied by transcription factors that are considerably enriched in liver cells compared with spleen or kidney. The proteins binding to these sites were investigated by a combination of DNase I footprinting assay and electrophoretic mobility-shift assay with the addition of specific oligonucleotide competitors and specific antibody against known transcription factors. As a result it was revealed that hepatocyte nuclear factor 3 binds to site B (-120 to -70), and CCAAT/enhancer binding protein alpha (C/EBPalpha) and C/EBPbeta bind to site F (-375 to -356) and site H (-500 to -471). The binding of C/EBP to sites F and H was markedly decreased within 4 h when liver cells were subjected to primary culture, suggesting that C/EBP might be responsible for the decreased expression of GLUT2 in this process. In contrast, Western blot analysis revealed that C/EBPalpha began to decrease after 1 h of hepatocyte culture, and C/EBPbeta was not changed significantly throughout the culture period, suggesting that C/EBP could be regulated at the transcriptional level as well as the post-translational level when hepatocytes were put in culture. To confirm the role of C/EBP in the regulation of GLUT2 promoter activity, sites F and H were ligated to a chloramphenicol acetyltransferase (CAT) reporter gene and co-transfected with a C/EBP expression vector into HepG2 cells. The co-expression of C/EBPalpha and C/EBPbeta resulted in 9.1-fold and 3. 8-fold increases of CAT activities in the site F-CAT and site H-CAT constructs respectively. These results indicate that C/EBPalpha and C/EBPbeta regulate the promoter activity of the GLUT2 gene and might be responsible for the down-regulation of the GLUT2 gene when hepatocytes are subjected to primary culture.
...
PMID:CCAAT/enhancer binding protein regulates the promoter activity of the rat GLUT2 glucose transporter gene in liver cells. 980 88

The long PCR technique was used to amplify the three size classes of viral mRNAs produced in cells infected by feline immunodeficiency virus (FIV). We identified in the env region a new splice acceptor site that generated two transcripts, each coding for an 11-kDa protein, p11(rev), whose function is unknown. The small-size class of mRNAs included two bicistronic orf2/rev mRNAs and two rev-like mRNAs, consisting only of the second exon of rev and coding for a 15-kDa protein, p15(rev). p15(rev) contained the minimal effector domain of Rev and was sufficient to mediate partial Rev activity. The bicistronic mRNAs encoded two distinct proteins, one of 23 kDa corresponding to Rev and a 9-kDa protein encoded by the orf2 gene. The orf2 gene product is a protein of 79 amino acids with characteristics similar to those of the Tat (transactivator) proteins of the ungulate lentiviruses. Transient expression assays, using the FIV long terminal repeat (LTR) to drive transcription of the bacterial gene for chloramphenicol acetyltransferase demonstrated that the orf2 gene transactivates gene expression an average of 14- to 20-fold above the basal level. Deletion mutants of the FIV LTR were generated to locate sequences responsive to transactivation mediated by the orf2 gene. A 5' deletion mutant that removed the AP1 site resulted in residual low-level transactivation by orf2. Further experiments using LTR mutants with internal deletions identified three regions located between positions -126 and -47 relative to the cap site that were important for orf2-directed transactivation. These regions include the AP1 site, a C/EBP tandem repeat, and an ATF site.
...
PMID:Demonstration that orf2 encodes the feline immunodeficiency virus transactivating (Tat) protein and characterization of a unique gene product with partial rev activity. 984 66

The hepatitis B viral X protein (HBx) is known to exert its transactivation activity by the interaction with several cellular transcription factors. Here we report the interaction of HBx and CCAAT/enhancer-binding protein alpha (C/EBPalpha) and their effects on the enhancer/promoters of hepatitis B virus (HBV). A chloramphenicol acetyltransferase assay showed that the cotransfection of HBx and C/EBPalpha strongly activated the enhancer II/pregenomic promoter of HBV in a synergistic manner. This effect was also observed in the heterologous expression system with promoters of SV40 and herpes simplex virus thymidine kinase genes. Serial deletion analysis of the enhancer II/pregenomic promoter identified the responsible region (nucleotides 1639-1679), in which two C/EBP-binding sites are located. An in vitro interaction assay and electrophoretic mobility shift assay showed that HBx augmented the DNA binding activity of C/EBPalpha by direct interaction with it, and its basic leucine zipper domain was responsible for the interaction with HBx. Domain analysis of HBx showed that the central region (amino acids 78-103) was necessary for direct interaction with C/EBPalpha. However, the complete form of HBx was necessary for the synergistic activation of the HBV pregenomic promoter. These results suggest that the interaction of HBx and C/EBPalpha enhances the transcription of the HBV pregenomic promoter for the effective life cycle of HBV in hepatocytes.
...
PMID:Interaction of hepatitis B viral X protein and CCAAT/ enhancer-binding protein alpha synergistically activates the hepatitis B viral enhancer II/pregenomic promoter. 991 21

The cyclic AMP response element (CRE) of the rat phosphoenolpyruvate carboxykinase (PEPCK) gene promoter is required for a complete glucocorticoid response. Proteins known to bind the PEPCK CRE include the CRE-binding protein (CREB) and members of the CCAAT/enhancer-binding protein (C/EBP) family. We took two different approaches to determine which of these proteins provides the accessory factor activity for the glucocorticoid response from the PEPCK CRE. The first strategy involved replacing the CRE of the PEPCK promoter/chloramphenicol acetyltransferase reporter plasmid (pPL32) with a consensus C/EBP-binding sequence. This construct, termed pDeltaCREC/EBP, binds C/EBPalpha and beta but not CREB, yet it confers a nearly complete glucocorticoid response when transiently transfected into H4IIE rat hepatoma cells. These results suggest that one of the C/EBP family members may be the accessory factor. The second strategy involved co-transfecting H4IIE cells with a pPL32 mutant, in which the CRE was replaced with a GAL4-binding sequence (pDeltaCREGAL4), and various GAL4 DNA-binding domain (DBD) fusion protein expression vectors. Although chimeric proteins consisting of the GAL4 DBD fused to either CREB or C/EBPalpha are able to confer an increase in basal transcription, they do not facilitate the glucocorticoid response. In contrast, a fusion protein consisting of the GAL4 DBD and amino acids 1-118 of C/EBPbeta provides a significant glucocorticoid response. Additional GAL4 fusion studies were done to map the minimal domain of C/EBPbeta needed for accessory factor activity to the glucocorticoid response. Chimeric proteins containing amino acid regions 1-84, 52-118, or 85-118 of C/EBPbeta fused to the GAL4 DBD do not mediate a glucocorticoid response. We conclude that the amino terminus of C/EBPbeta contains a multicomponent domain necessary to confer accessory factor activity to the glucocorticoid response from the CRE of the PEPCK gene promoter.
...
PMID:CCAAT/enhancer-binding protein beta is an accessory factor for the glucocorticoid response from the cAMP response element in the rat phosphoenolpyruvate carboxykinase gene promoter. 1002 11

Several reports have shown that bicyclic imidazoles, specific inhibitors of the p38 mitogen-activated protein kinase (MAPK), block cytokine synthesis at the translational level. In this study, we examined the role of p38 MAPK in the regulation of the IL-1beta cytokine gene in monocytic cell lines using the bicyclic imidazole SB203580. Addition of SB203580 30 min before stimulation of monocytes with LPS inhibited IL-1beta protein and steady state message in a dose-dependent manner in both RAW264.7 and J774 cell lines. The loss of IL-1beta message was due mainly to inhibition of transcription, since nuclear run-off analysis showed an approximately 80% decrease in specific IL-1 RNA synthesis. In contrast, SB203580 had no effect on the synthesis of TNF-alpha message. LPS-stimulated p38 MAPK activity in the RAW264.7 cells was blocked by SB203580, as measured by the inhibition of MAPKAP2 kinase activity, a downstream target of the p38 MAPK. CCAATT/enhancer binding protein (C/EBP)/NFIL-6-driven chloramphenicol acetyltransferase (CAT) reporter activity was sensitive to SB203580, indicating that C/EBP/NFIL-6 transcription factor(s) are also targets of p38 MAPK. In contrast, transfected CAT constructs containing NF-kappaB elements were only partially inhibited (approximately 35%) at the highest concentration of SB203580 after LPS stimulation. As measured by EMSA, LPS-stimulated NF-kappaB activation was not affected by SB203580. Overall, the results demonstrate, for the first time, a role for p38 MAPK in IL-1beta transcription by acting through C/EBP/NFIL-6 transcription factors.
...
PMID:The role of p38 mitogen-activated protein kinase in IL-1 beta transcription. 1022 13

Rat 3alpha-hydroxysteroid/dihydrodiol dehydrogenase (3alpha-HSD/DD; AKR1C9), a member of the aldo-keto reductase (AKR) superfamily, inactivates nearly all steroid hormones by converting 5alpha- and 5beta-dihydrosteroids to their respective 3alpha,5alpha- and 3alpha,5beta-tetrahydrosteroids and protects against circulating steroid hormone excess. It is highly expressed in rat liver comprising 0.5-1.0% of the soluble protein. Previously, we identified a powerful distal enhancer resident at about -4.0 kb to -2.0 kb in the 5'-flanking region of the 3alpha-HSD/DD gene. We now report the functional dissection of this enhancer. Transfection of nested deletions of the 5'-end of the gene promoter linked to chloramphenicol acetyltransferase (CAT) into HepG2 cells located the enhancer activity between (-4673 to -4179 bp). Further internal and 5'-end deletion mutants revealed that a 73-bp fragment (from -4351 to -4279 bp) contained a major enhancer element. This fragment spanned two imperfect direct repeats GTGGAAAAACCCAGGAA and GTGGAAAAAACCCAGGAA and contained three direct repeats of GGAAAAA. This fragment also contained three potential half-nuclear factor 1 (NF1) sites (TGGA-NNNNNGCCA) and a putative CCAAT-enhancer binding protein (C/EBP) binding site. The 73-bp fragment enhanced CAT activity from the basal 3alpha-HSD/DD gene promoter. Recombinant C/EBPalpha and C/EBPbeta did not bind to this fragment. Electrophoretic mobility shift assays showed that HepG2 and rat liver nuclear extracts bound to this 73-bp fragment. The 73-bp protein complex was competed out by a NF1 oligonucleotide and was supershifted by an NF1 antibody. When the 73-bp fragment was fused to an alpha1-globin promoter-CAT construct and cotransfected with CCAAT transcription factor 1 (CTF1)/NF1 into Drosophila Schneider SL2 insect cells (which lack NF1-like proteins) trans-activation of CAT activity was observed. These results indicate that members of the NF1 transcription factor family regulate high constitutive expression of the rat 3alpha-HSD/DD gene that is responsible for steroid hormone inactivation. The potential role of NF1 in regulating other AKR genes that have protective roles is discussed.
...
PMID:Members of the nuclear factor 1 transcription factor family regulate rat 3alpha-hydroxysteroid/dihydrodiol dehydrogenase (3alpha-HSD/DD AKR1C9) gene expression: a member of the aldo-keto reductase superfamily. 1051 72

Adipocyte amino acid transporter (AAAT) is induced during the 3T3-L1 preadipocyte differentiation process. In the -1819-bp 5'-upstream flanking region of the AAAT genomic gene, six DNase I protected sites were identified by using the 3T3-L1 adipocyte nuclear extract. Results of chloramphenicol acetyltransferase (CAT) expression from the chimeric AAAT promoter-driven CAT reporter gene indicated that one protein binding site, from -68 to -26, was essential for the promoter activity. However, this protein binding site does not contain recognition sites of the transcription factors important for adipocyte differentiation, i.e., the C/EBP or PPAR family. Further analysis revealed that the DNA sequence, TTCAAGTCCCGCCCTCCGCT from -65 to -46, was the cis-element essential and partially sufficient for inducible activity of the AAAT gene promoter.
...
PMID:An SP1-like cis-element is the major DNA motif for differential expression regulation of the adipocyte amino acid transporter. 1077 87

Treatment of foetal brown adipocytes in primary culture with either dexamethasone or insulin, at physiological concentrations, for 24 h up-regulates the expression of the GLUT4 gene, producing a synergistic effect on mRNA accumulation (20-fold increase), in the amount of protein in the total membrane fraction (8-fold increase) and in the transactivation of a full-promoter GLUT4 -chloramphenicol acetyltransferase gene ( CAT ) construct (7-fold increase). However, GLUT1 expression remains essentially unmodified regardless of the presence of the hormones. As a consequence, exposure of brown adipocytes to dexamethasone and insulin results in a dramatic increase of glucose uptake (12-fold). Dexamethasone induces the expression of CCAAT/enhancer-binding protein (C/EBP) alpha, insulin promotes myocyte enhancer factor-2 DNA-binding activity and both combined produces a significant increase in C/EBPalpha DNA-binding activity. Moreover, co-transfection with a wild-type C/EBPalpha construct transactivates a full-promoter GLUT4 - CAT fusion gene, whereas a dominant-negative C/EBPalpha expression vector impairs the hormonal effects. Our results show that the synergism between insulin and glucocorticoids on glucose uptake is a consequence of the activation of the GLUT4 promoter by the transcription factor C/EBPalpha.
...
PMID:Insulin and dexamethasone induce GLUT4 gene expression in foetal brown adipocytes: synergistic effect through CCAAT/enhancer-binding protein alpha. 1264 95

ZO-2 is a membrane-associated guanylate kinase (MAGUK) protein present at the tight junction (TJ) of epithelial cells. While confluent monolayers have ZO-2 at their cellular borders, sparse cultures conspicuously show ZO-2 at the nuclei. To study the role of nuclear ZO-2, we tested by pull-down assays and gel shift analysis the interaction between ZO-2 GST fusion proteins and different transcription factors. We identified the existence of a specific interaction of ZO-2 with Fos, Jun and C/EBP (CCAAT/enhancer binding protein). To analyze if this association is present "in vivo", we performed immunoprecipitation and immunolocalization experiments, which revealed an interaction of ZO-2 with Jun, Fos and C/EBP not only at the nucleus but also at the TJ region. To test if the association of ZO-2 with AP-1 (activator protein-1) modulates gene transcription, we performed reporter gene assays employing chloramphenicol acetyltransferase (CAT) constructs with promoters under the control of AP-1 sites. We observed that the co-transfected ZO-2 down-regulates CAT expression in a dose-dependent manner. Since ZO-2 is a multidomain protein, we proceeded to determine which region of the molecule is responsible for the modulation of gene expression, and observed that both the amino and the carboxyl domains are capable of inhibiting gene transcription.
...
PMID:The tight junction protein ZO-2 associates with Jun, Fos and C/EBP transcription factors in epithelial cells. 1472 May 6


<< Previous 1 2 3 4 5 6 7 8 Next >>

---