Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
 5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The isolation and characterization of the rat genomic clone encoding the cholesterogenic enzyme farnesyl diphosphate (FPP) synthase is reported. The gene is localized on a 15-kilobase (kb) genomic fragment, spans approximately 12 kb and contains eight exons. Sequences containing from 3.9 kb to 132 base pairs (bp) of the putative promoter were joined to the coding region of the bacterial reporter gene chloramphenicol acetyltransferase (CAT). The CAT activities or CAT mRNA levels of the hybrid genes were determined following either transient transfections into human hepatoma HepG2 cells or stable transfections into Chinese hamster ovary cells. The transient transfections identified a 319-bp fragment that was required for a 4-fold induction in the absence of sterols. Sequence analysis of this region showed it contained five potential copies of the sterol regulatory element (SRE-1) (Smith, J.R., Osborne, T.F., Brown, M.S., Goldstein, J.L., and Gil, G. (1988) J. Biol. Chem. 263, 18480-18487) previously identified in the promoters of the 3-hydroxy-3-methyl-coenzyme A (HMG-CoA) reductase, HMG-CoA synthase, and low density lipoprotein receptor genes. Further mutational and deletion analysis of the FPP synthase promoter-CAT constructs followed by stable transfection and primer extension of the CAT mRNA levels indicated that these potential SRE-1 regulatory elements were not involved in the sterol-mediated transcriptional regulation of the gene. Our analyses have identified a 115-bp region that is required for the transcriptional induction of FPP synthase in the absence of sterols. These results suggest that the FPP synthase gene may be regulated at the transcriptional level by a different mechanism than other sterol regulated genes.
 ...
PMID:Molecular cloning and promoter analysis of the rat liver farnesyl diphosphate synthase gene. 132 Nov 49

Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene.
 ...
PMID:Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components. 299 67

A transforming growth factor-beta (TGF-beta) activating element (TAE), with a nuclear factor-1 (NF-1)-like sequence, was previously located 1.6 kilobases upstream from the transcription start site in the alpha 1(I) collagen promoter (Ritzenthaler, J. D., Goldstein, R. H., Fine, A., Lichtler, A., Rowe, D. W., and Smith, B. D. (1991) Biochem. J. 280, 157-162). Double-stranded TAE, but not NF-1 consensus sequences, abrogated TGF-beta stimulation of co-transfected collagen promoter-chloramphenicol acetyltransferase constructs. Mutations in non-NF-1 binding sites, located by methylation interference, eliminated activity of the TAE oligonucleotide. However, TAE sequences failed to bind in vitro expressed NF-1 protein, to compete for NF-1-binding proteins, and to bind with protein which reacts with antibodies to NF-1 family of proteins. Within the TAE there was an activator protein 2 (AP-2) binding site. Although AP-2 protein bound to TAE, antibodies to AP-2 did not react with nuclear protein-TAE complexes. TAE bound to a 34,000-Da protein on Southwestern analysis. However, the UV-cross-linked TAE-nuclear protein complex was 82,000 Da. Finally, a dose-response study demonstrated that TGF-beta increased TAE nuclear binding proteins at lower doses with a different response curve than NF-1 nuclear binding proteins. Taken together these data demonstrated that TGF-beta functions in human lung fibroblasts to activate collagen transcription through TAE sites by protein complexes independent of NF-1 or AP-2 protein.
 ...
PMID:Regulation of the alpha 1(I) collagen promoter via a transforming growth factor-beta activation element. 851 94