Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The bovine leukemia virus, like the human T-cell leukemia viruses (HTLV-I and HTLV-II), are unusual biologically in that viral transcripts are not detected in tumors or infected tissues. The bovine leukemia virus long terminal repeat (BLV LTR) functions as a transcriptional promoter only in cell lines productively infected with BLV. Deletion mapping indicated that at least two regions of the LTR, on the 5' and 3' sides of the RNA start site, influenced gene expression. An analysis has now been made of the effects of coupling sequences from these LTR regions to a heterologous core promoter derived from the SV40 early promoter unit. Through the use of the transient expression of the bacterial chloramphenicol acetyltransferase (CAT) gene to monitor transcriptional activity in vivo, two independent, regulatory elements were identified in the BLV LTR. One was present in a fragment of 75 base pairs derived from the U3 region of the LTR and behaved much like other enhancer elements. It may be a major determinant of BLV expression in productively infected cell lines, since it enhanced transcription controlled by the heterologous core promoter only in these cells. The second element was contained in a 250-bp fragment derived from LTR sequences in the R region, located downstream from the RNA start site. Its activation of CAT expression was not dependent on BLV infection and was evident only when the fragment was located immediately downstream from the RNA start site. BLV expression thus appears to be regulated in part by a cell-specific enhancer element upstream from the core promoter and a novel sequence downstream from the RNA initiation site in the viral LTR.
...
PMID:Two elements in the bovine leukemia virus long terminal repeat that regulate gene expression. 300 41

Human T-cell leukemia virus type I (HTLV-I), a virus associated with adult T-cell leukemia, contains a long open reading frame (LOR) in the 3' end of its genome between the env region and the 3' long terminal repeat (LTR). This open reading frame encodes a 40-kDa protein (designated p40x) that has been implicated as a positive control element for transcription from the HTLV-I LTR in a phenomenon known as trans-activation. We now report the expression of the complete p40x coding sequence as a 40-kDa protein in Escherichia coli. The p40x protein produced in bacteria is shown, using the protoplast fusion technique, to possess biological activity by its ability to trans-activate a HTLV-I LTR-chloramphenicol acetyltransferase plasmid that is stably integrated into the genome of mouse L cells. This stimulatory activity could be detected within 2 hr after fusion, suggesting the possibility of a direct role for p40x in trans-activation of the HTLV-I LTR. The production of p40x in large quantities in E. coli, together with the rapid protoplast fusion assay for its biological activity, should facilitate the analysis of p40x mutants and the elucidation of the molecular mechanism of trans-activation.
...
PMID:Expression of the complete human T-cell leukemia virus type I pX coding sequence as a functional protein in Escherichia coli. 302 May 38

Human T-cell leukemia virus type I (HTLV-I) contains the pX sequence which codes for the trans-activator of the long terminal repeat (LTR) and is thus postulated to be associated with leukemogenesis in adult T-cell leukemia. Overlapping open reading frames (ORF) in the pX sequence were recently found to code for p27x-III and p21x-III by ORF III, in addition to p40x coded for by ORF IV. The mechanism of expression of these newly identified proteins and their possible association with trans-activation were studied. On transfection of an expression plasmid that contains a cDNA sequence of the pX mRNA, products from both ORFs III and IV were detected in the cells. The RNA was synthesized in vitro from the cDNA clone by SP6 RNA polymerase and translated in a rabbit reticulocyte lysate. As translation products, two proteins, p27x-III and p21x-III, were detected in addition to p40x. Elimination of the first and second ATG codons in ORF III resulted in loss of the ability to code for p27x-III and p21x-III, respectively, which indicated that the translations from these two ATG codons were independent. A mutant that lacked both ATG codons was fully active in trans-activation of chloramphenicol acetyltransferase gene expression directed by the LTR. These results indicate that a 2.1-kilobase pX mRNA of HTLV-I independently encodes three proteins, p40x, p27x-III, and p21x-III, by different ORFs and that the last two proteins are not involved in trans-activation of the unintegrated LTR.
...
PMID:A single species of pX mRNA of human T-cell leukemia virus type I encodes trans-activator p40x and two other phosphoproteins. 302 74

Reticuloendotheliosis viruses (Rev) replicate in chicken and dog cells, but not in rat cells. Amphotropic murine leukemia viruses (Am-MLV) replicate in chicken, dog, and rat cells. Transcription from the Rev long terminal repeat, determined by the chloramphenicol acetyltransferase assay, was not significantly different from transcription from the MLV long terminal repeat in rat cells. To determine further the step(s) in the retroviral life cycle that is blocked for Rev replication in rat cells, we took advantage of the wide host range of Am-MLV (S. Rasheed, M. B. Gardner, and E. Chan, J. Virol. 19:13-18, 1976) and the ability to form Rev-Am-MLV pseudotypes. Data from these pseudotypes indicate that the block to Rev replication in rat cells is posttranscriptional.
...
PMID:Pseudotyped retroviral vectors reveal restrictions to reticuloendotheliosis virus replication in rat cells. 302 99

The cis-acting regulatory sequence of transcription from long terminal repeats (LTRs) of human T-cell leukemia virus type I and type II (HTLV-I and HTLV-II), which is essential for action of the virally encoded trans-acting transcriptional factor(s) designated pX(s), in HTLV-I and -II was identified. Deletion of most of the U3 region of the HTLV-I LTR resulted in loss of trans-acting transcriptional activation. However, when a tandem repeat of a 21-nucleotide sequence (GAAGGCTCTGACGTCTCCCCC) that is present in the U3 region of HTLV-I and -II LTRs was inserted into the deleted U3 region of the HTLV-I LTRs, chloramphenicol acetyltransferase activity was restored. The extent of restoration of activity was proportional to the number of copies of the sequence inserted. To test the possibility that the 21-nucleotide sequence alone is necessary for trans-activation, a sequence (AGGAACTGAAA) homologous to a type-specific viral enhancer sequence and present in the U3 region of HTLV-II LTR, but not in the same region of the HTLV-I LTR, was inserted together with the 21-nucleotide sequence into the deleted U3 region of the HTLV-I LTR. However, no significant differences of the levels of activities of those LTRs compared to the LTRs with only the 21-nucleotide sequence repeats were observed.
...
PMID:Requirement of multiple copies of a 21-nucleotide sequence in the U3 regions of human T-cell leukemia virus type I and type II long terminal repeats for trans-acting activation of transcription. 302 80

Nucleotide sequence analysis of the cellular sequences flanking the integrated ecotropic (mouse-infectious) murine leukemia provirus of BALB/c mice indicated that the murine leukemia provirus is integrated in opposing transcriptional orientation within a solo long terminal repeat (LTR) of the VL30 family of endogenous retrovirus-related sequences. To quantify the effect of this integration event on the ability of the ecotropic provirus to be expressed, we constructed recombinant molecules that carried the chloramphenicol acetyltransferase (cat) gene and various viral LTRs and determined the CAT activity induced by these constructs after transfection of NIH 3T3 cells. Our results indicate that the BALB/c ecotropic LTR is about 10-fold more active than the VL30 LTR. The presence of the VL30 LTR did not affect the transcriptional activity of the ecotropic LTR in the context of the integration event. Our results also indicate that the LTRs of the BALB/c provirus are less transcriptionally active than are the proviral LTRs of AKR murine leukemia virus and the Harvey murine sarcoma virus.
...
PMID:Germ line integration of a murine leukemia provirus into a retroviruslike sequence. 302 96

We isolated the full length provirus of human T cell leukaemia virus type I (HTLV-I) from MT-2, a lymphoid cell line producing HTLV-I. In three non-lymphoid cell lines (COS7, human osteosarcoma HOS cells, and HeLa) this provirus expressed a trans-acting activity after co-transfection with a recombinant plasmid carrying a bacterial chloramphenicol acetyltransferase gene under the control of a long terminal repeat of HTLV-I provirus. The trans-acting protein p40 was detected by immunoprecipitation in transfected HOS cells. Structural proteins of HTLV-I, the gag and env products, were also formed and processed in the same manner as observed in MT-2 cells. In transfected HeLa cells, the p40 protein was mainly localized in the nucleus, while other structural proteins were detected in the cytoplasm and/or the membrane by indirect immunofluorescence. Syncytium formation was observed in HeLa cells after transfection. These results demonstrated that non-lymphoid cells could produce the major proteins of HTLV-I after DNA transfection of the cloned provirus.
...
PMID:Expression of a provirus of human T cell leukaemia virus type I by DNA transfection. 302 87

Recombination studies have established that retroviral long terminal repeats (LTRs) are important genetic determinants of the viral capacity to induce hematopoietic tumors and to specify the type of cell making up the tumor. Plasmids containing LTRs of several murine leukemia viruses linked to the chloramphenicol acetyltransferase gene were tested in transient assays to measure relative rates of transcriptional activity in different types of hematopoietic cells. LTRs of the thymomagenic viruses SL3-3, Moloney leukemia virus, and a Moloney mink cell focus-forming virus all expressed to higher levels than other LTRs in T-lymphocyte cell lines. Conversely, the LTRs of Friend leukemia virus and a polycythemic spleen focus-forming virus expressed to higher levels than other LTRs in erythroleukemia cells. The LTR of nonleukemogenic Akv virus induced a relatively low level of activity compared with the others in all cells tested. Thus the relative level of LTR-driven expression in various types of cells corresponds to the type of tumor caused by the intact virus in vivo. These results provide direct evidence that the tissue specificity of the transcriptional activity of LTRs plays a critical role in determining the target cell for retroviral oncogenesis.
...
PMID:Correlation of leukemogenic potential of murine retroviruses with transcriptional tissue preference of the viral long terminal repeats. 302

Gibbon ape leukemia viruses (GALV) are a group of retroviruses which have been associated with hematopoietic neoplasms in primates. Two of the viruses, GALV-SEATO and GALV-San Francisco (GALV-SF), are associated with myeloid and lymphocytic leukemias, respectively, in apes. Using an assay based on the transient expression of the bacterial gene chloramphenicol acetyltransferase (CAT), we examined the transcriptional activity of GALV-SEATO and GALV-SF. The results suggest that high level expression of GALV is due primarily to cis-acting enhancer sequences. Sequence delineation analysis of GALV-SEATO showed the GALV-SEATO enhancer sequences to be located within a 45-bp tandem repeat in GALV-SEATO. GALV-SF, which has two- to fivefold lower transcriptional activity, contains only a single copy of the 45-bp element with 6-bp differences from those in the GALV-SEATO enhancer element. This 45-bp element is highly homologous to sequences within the LTRs of several murine leukemia viruses but has not been examined for enhancer function in these retroviruses. Expression of GALV was not restricted to hematopoietic cells but was extraordinarily high in MLA 144 cells, a gibbon ape T-cell line known to be infected with GALV-SF. However, expression of constructs containing the CAT gene directed by GALV-SEATO LTR sequences was similar in uninfected and GALV-infected fibroblasts, indicating the lack of virally encoded or virally induced trans-activating factors capable of increasing expression in these cells.
...
PMID:Cis-acting transcriptional regulatory sequences in the gibbon ape leukemia virus (GALV) long terminal repeat. 302 59

A retroviral host-range neomycin-resistant myeloproliferative sarcoma virus mutant, which is expressed in the embryonal carcinoma cell lines F9 and PCC4aza1R, was molecularly cloned and analyzed. This mutant virus, PCMV, differs from myeloproliferative sarcoma virus by two major deletions, one of which spans exactly a 75-base-pair repeat of the long terminal repeat. Functional analysis of recombinant viruses shows that the host-range expansion of PCMV is a property of nucleotide changes within the U3 region of the long terminal repeat. Furthermore, expression assays of chimeric long terminal repeats show that the enhancer region of PCMV joined to the promoter region of Moloney murine leukemia virus is sufficient to direct the synthesis of chloramphenicol acetyltransferase in F9 and PCC4 cells.
...
PMID:Functional analysis of a retroviral host-range mutant: altered long terminal repeat sequences allow expression in embryonal carcinoma cells. 303 39


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>

---