Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The mechanism by which the human T-cell leukemia viruses type I and II (HTLV-I and -II) transform T cells is unknown, but the nonstructural Tax protein that these viruses produce is known to be essential for viral replication and to have the capacity to trans-activate cellular gene expression. The HTLV-I and -II Tax proteins have been shown to activate the promoter of both the human and mouse granulocyte-macrophage colony-stimulating factor (GM-CSF) genes in mature T-cell lines. T-cell-specific Tax-responsive sequences were previously localized to the 90-bp region extending from base pairs -53 to +37 in the human GM-CSF promoter. In this study, a series of site-directed and deletion mutations were created in the human GM-CSF promoter, which was linked to the chloramphenicol acetyltransferase (CAT) gene, and the constructs were assayed for their response to Tax by using a Tax-expressing plasmid in transient cotransfection assays. The results demonstrated that both copies of the repeated sequence CATTA (A/T), located between base pairs -48 and -36, are required for Tax responsiveness in T cells and that these sequences bind nuclear factors present in T cells. The Tax-responsiveness of other sequences located 5' of base pair -53 was also examined, including an NF-kappa B consensus sequence and the CK1, CK2, and GC-rich regions identified in both the mouse and human GM-CSF promoters. These sequences did not have Tax-responsive regulatory activity when they were examined in the context of the intact human GM-CSF promoter in T cells.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Tax responsiveness of the GM-CSF promoter is mediated by mitogen-inducible sequences other than kappa B. 176 53

Human T-cell leukemia virus type I (HTLV-I)-infected T-cell lines constitutively produce high levels of biologically active lymphotoxin (LT; tumor necrosis factor-beta) protein and LT mRNA. To understand the regulation of LT transcription by HTLV-I, we analyzed the ability of a series of deletions of the LT promoter to drive the chloramphenicol acetyltransferase (CAT) reporter gene in HTLV-I-positive MT-2 cells. The smallest LT promoter fragment (-140 to +77) that was able to drive CAT activity contained a site that was similar to the immunoglobulin kappa-chain NF-kappa B-binding site. Since the HTLV-I tax gene activates the nuclear form of NF-kappa B, this finding suggested a possible means of HTLV-I activation of LT production. We found that the LT kappa B-like site specifically formed a complex with NF-kappa B-containing nuclear extract from MT-2, C81-66-45, and other activated T cells. Mutation of the LT kappa B site in the context of the LT promoter (-293 to +77) (mutant M1) reduced the ability of the promoter to drive the CAT gene in HTLV-I-infected and noninfected human T-cell lines. These data suggest a general role for NF-kappa B activation in the induction of LT gene transcription. Activation of LT in HTLV-I-infected cells may explain the pathology associated with HTLV-I infection, including the hypercalcemia that is prevalent in adult T-cell leukemia.
...
PMID:Lymphotoxin activation by human T-cell leukemia virus type I-infected cell lines: role for NF-kappa B. 197 20

Human T-cell leukemia virus type I has a unique sequence pX and the product p40x was proposed to be a specific trans-acting transcriptional activator of expression of the viral gene. Recently, a second pX protein p27x-III in addition to p40x was identified; these two proteins are encoded by overlapping frames III and IV (x-lor). For determination of which product is the trans-acting activator, site-directed mutations were introduced into the pX sequence which was placed under the metallothionein promoter. On cotransfection with pLTR-CAT (a plasmid containing the LTR of HTLV-I and chloramphenicol acetyltransferase gene), only the mutations that affected p40x expression inactivated the transcriptional activation from the LTR.
...
PMID:The p40x of human T-cell leukemia virus type I is a trans-acting activator of viral gene transcription. 300 3

The ability of the sequences present in the long terminal repeats (LTRs) of human T-cell leukemia viruses type I and II (HTLV-I and HTLV-II) and of bovine leukemia virus to function as enhancer elements was investigated. Recombinant plasmids that contained the HTLV-I, HTLV-II, and bovine leukemia virus LTRs at a distance from a simian virus 40 promoter element located 5' to the bacterial gene encoding chloramphenicol acetyltransferase (EC 2.3.1.28) were constructed. We report that all three LTR sequences contain enhancer elements capable of increasing the level of gene expression directed from a distal heterologous promoter. The enhancer present in the HTLV-I LTR was active in uninfected cells of lymphoid and nonlymphoid origin. In contrast, the enhancer activity of the HTLV-II and bovine leukemia virus LTR sequences was evident only in virus-infected cells. This activity is likely due to virus-associated trans-acting transcriptional factors previously shown to be present in HTLV- and bovine leukemia virus-infected cells. The implication of these observations for virus replication and transforming activity are discussed.
...
PMID:Activation of enhancer sequences in type II human T-cell leukemia virus and bovine leukemia virus long terminal repeats by virus-associated trans-acting regulatory factors. 300 24

The bovine leukemia virus, like the human T-cell leukemia viruses (HTLV-I and HTLV-II), are unusual biologically in that viral transcripts are not detected in tumors or infected tissues. The bovine leukemia virus long terminal repeat (BLV LTR) functions as a transcriptional promoter only in cell lines productively infected with BLV. Deletion mapping indicated that at least two regions of the LTR, on the 5' and 3' sides of the RNA start site, influenced gene expression. An analysis has now been made of the effects of coupling sequences from these LTR regions to a heterologous core promoter derived from the SV40 early promoter unit. Through the use of the transient expression of the bacterial chloramphenicol acetyltransferase (CAT) gene to monitor transcriptional activity in vivo, two independent, regulatory elements were identified in the BLV LTR. One was present in a fragment of 75 base pairs derived from the U3 region of the LTR and behaved much like other enhancer elements. It may be a major determinant of BLV expression in productively infected cell lines, since it enhanced transcription controlled by the heterologous core promoter only in these cells. The second element was contained in a 250-bp fragment derived from LTR sequences in the R region, located downstream from the RNA start site. Its activation of CAT expression was not dependent on BLV infection and was evident only when the fragment was located immediately downstream from the RNA start site. BLV expression thus appears to be regulated in part by a cell-specific enhancer element upstream from the core promoter and a novel sequence downstream from the RNA initiation site in the viral LTR.
...
PMID:Two elements in the bovine leukemia virus long terminal repeat that regulate gene expression. 300 41

The cis-acting regulatory sequence of transcription from long terminal repeats (LTRs) of human T-cell leukemia virus type I and type II (HTLV-I and HTLV-II), which is essential for action of the virally encoded trans-acting transcriptional factor(s) designated pX(s), in HTLV-I and -II was identified. Deletion of most of the U3 region of the HTLV-I LTR resulted in loss of trans-acting transcriptional activation. However, when a tandem repeat of a 21-nucleotide sequence (GAAGGCTCTGACGTCTCCCCC) that is present in the U3 region of HTLV-I and -II LTRs was inserted into the deleted U3 region of the HTLV-I LTRs, chloramphenicol acetyltransferase activity was restored. The extent of restoration of activity was proportional to the number of copies of the sequence inserted. To test the possibility that the 21-nucleotide sequence alone is necessary for trans-activation, a sequence (AGGAACTGAAA) homologous to a type-specific viral enhancer sequence and present in the U3 region of HTLV-II LTR, but not in the same region of the HTLV-I LTR, was inserted together with the 21-nucleotide sequence into the deleted U3 region of the HTLV-I LTR. However, no significant differences of the levels of activities of those LTRs compared to the LTRs with only the 21-nucleotide sequence repeats were observed.
...
PMID:Requirement of multiple copies of a 21-nucleotide sequence in the U3 regions of human T-cell leukemia virus type I and type II long terminal repeats for trans-acting activation of transcription. 302 80

The regulatory element (RE) of the human leukosialin (LS)-encoding gene, that encodes a major sialoglycoprotein of human leukocyte and platelet membranes, was used to develop a novel expression vector, pKX. The vector was constructed by cloning a RE fragment and the SV40 fragment containing polyadenylation and splicing signals between HindIII and BamHI sites of the pCAT-Basic vector. The transcription level controlled by this vector was evaluated in six different cell lines using a transient expression assay of chloramphenicol acetyltransferase (CAT). The CAT activity of the pKX vector was compared to the other common expression vectors, namely pMSG (driven by the mouse mammary tumor virus LTR), pcDL-SR alpha (SV40 promoter/enhancer and HTLV-I LTR), pcDNAI (cytomegalovirus promoter/enhancer) and pCAT-Control (SV40 promoter/enhancer). The level of expression provided by the pKX vector was comparable to that observed with pcDNAI and pcDL-SR alpha vectors. In different mammalian cell lines, the highest efficiency of expression of the pKX vector was observed in the human T-cell lines, Jurkat and CEM, although the expression of pcDL-SR alpha-CAT in those cell lines was in the same range. The expression of the pKX vector driven by a non-viral promoter and/or enhancer can be as efficient as that driven by a viral promoter and/or enhancer. Potential uses of this vector may be found in studies of transient gene expression in hematopoietic cells and for gene therapy, particularly the ones involving T-cells.
...
PMID:A novel expression vector composed of a regulatory element of the human leukosialin-encoding gene in different types of mammalian cells. 764 11

The vimentin gene is a member of the intermediate filament multigene family and encodes a protein expressed, in vivo, in all mesenchymal derivatives and, in vitro, in cell types of various origin. We have previously demonstrated that the expression of this growth-regulated gene could be trans activated by the 40-kDa Tax protein of HTLV-I (human T-cell leukemia virus type I) and that responsiveness to this viral protein was mediated by the presence of an NF-kappa B binding site located between -241 and -210 bp upstream of the mRNA cap site (A. Lilienbaum, M. Duc Dodon, C. Alexandre, L. Gazzolo, and D. Paulin, J. Virol. 64:256-263, 1990). These previous assays, performed with deletion mutants of the vimentin promoter linked to the chloramphenicol acetyltransferase gene, also revealed the presence of an upstream negative region between -529 and -241 bp. Interestingly, the inhibitory activity exerted by this negative region was overcome after cotransfection of a Tax-expressing plasmid. In this study, we further characterize the vimentin negative element and define the effect of the Tax protein on the inhibitory activity of this element. We first demonstrate that a 187-bp domain (-424 to -237 bp) behaves as a negative region when placed upstream either of the NF-kappa B binding site of vimentin or of a heterologous enhancer such as that present in the desmin gene promoter. The negative effect can be further assigned to a 32-bp element which is indeed shown to repress the basal or induced activity of the NF-kappa B binding site.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Identification of a negative element in the human vimentin promoter: modulation by the human T-cell leukemia virus type I Tax protein. 841 64

CD8+ T lymphocytes of HIV-1-infected individuals can efficiently suppress HIV-1 replication in CD4+ T lymphocytes. To elucidate the molecular events underlying this suppression, we have used the HIV-1 LTR directing the chloramphenicol acetyltransferase gene (CAT) in transient transfection assays using human Jurkat T cells. In addition to supernatants of patient CD8+ T lymphocytes (CD4+ > 350/microliters), supernatant of a T cell clone derived by Herpesvirus saimiri (HVS)-mediated transformation of CD8+ T lymphocytes of a patient demonstrating inhibition of virus replication were examined. Similar levels of inhibition of LTR-mediated gene expression in response to Tat or mitogenic activation with phorbol ester and calcium ionophore were observed by supernatants of both sources. The inhibitory effect of CD8+ T lymphocytes was not exclusive to lentiviral LTRs since transcription of both the HTLV-I LTR and RSV LTR in response to mitogen was effectively inhibited. In examination of the influence of CD8+ T cell-derived supernatant on NF kappa B-mediated activation, a dimer of the HIV-1 NF kappa B elements directing CAT was markedly inhibited by supernatants of both patient CD8+ lymphocytes and the HVS-derived CD8+ clone. Thus the inhibitory nature of CD8+ T lymphocytes appears not to be specific to lentiviral promoters and may mediate an inhibitory effect via the NF kappa B element.
...
PMID:Suppression of activation of the human immunodeficiency virus long terminal repeat by CD8+ T cells is not lentivirus specific. 857 88

HIV-1 infection has been documented in rabbits, but infection proceeds slowly in this species. Human and rabbit cell lines were compared in order to identify barriers to efficient HIV-1 infection of rabbit cells. A direct comparison of human and rabbit CD4 as receptor for HIV-1 indicated that the rabbit CD4 homolog did not function well even when expressed by human cells. Examination of viral RNA production indicated that the major HIV transcripts were produced in HIV-infected rabbit cells, but were present at levels significantly lower than those found for human cells. Ability of HIV-1 LTRs to direct protein expression in human and rabbit cells was compared using gene constructs with the chloramphenicol acetyltransferase (cat) gene flanked by HIV-1 LTRs. Chloramphenicol acetyltransferase protein expression was equivalent in rabbit and human cell lines transfected with the HIV-1/CAT constructs and cotransfections with the HIV-1 tat gene led to similar increases in CAT expression. Subsequent transfections with an infectious molecular HIV clone yielded approximately equal levels of HIV protein expression in rabbit and human cell lines, suggesting that major barriers to virus production in rabbit lines exist at steps prior to transcription of the viral genome. Because HTLV-I replicates with high efficiency in rabbit cells, a chimeric virus clone was constructed consisting of the 5' portion of HIV-1 through the nef coding sequence followed by the 3' HTLV-I LTR. Transfection of most rabbit cell lines with the chimera produced levels of p24gag protein higher than those transfected with the parent HIV-1 clone. By contrast, the unmodified HIV clone replicated more efficiently in all human cell lines tested.
...
PMID:Replication of HIV type 1 in rabbit cell lines is not limited by deficiencies in tat, rev, or long terminal repeat function. 867 93


1 2 Next >>

---