Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene.
...
PMID:Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components. 299 67

The requirements for expression of genes under the control of early (alkaline exonuclease) and late (VP5) herpes simplex virus type 1 (HSV-1) gene promoters were examined in a transient expression assay, using the bacterial chloramphenicol acetyltransferase gene as an expression marker. Both promoters were induced, resulting in the production of high levels of the enzyme upon low-multiplicity infection by HSV-1. S1 nuclease analysis of hybrids between RNA isolated from infected cells containing HSV-1 promoter constructs and marker gene DNA demonstrated normal transcriptional initiation of the marker gene directed by the viral promoters. Viral DNA sequences no more than 125 bases 5' of the putative transcriptional cap site were sufficient for maximum activity of the late promoter. In contrast to expression controlled by the early gene, the late promoter was not active at a measurable level in uninfected cells until DNA sequences between 75 and 125 bases 5' of the transcriptional cap site were deleted. Cotransfection of cells with the expression marker controlled by HSV promoters and a cosmid containing HSV alpha (immediate-early) genes indicated that full expression of both early and late promoters requires the same virus-induced host cell modifications. Inhibition of viral DNA synthesis results in an increased rate of transient expression of marker genes under control of either early or late promoters in contrast to the situation in normal virus infection. These data provide evidence that the normal course of expression of late HSV genes involves negative modulation of potentially active promoters in the infected cell.
...
PMID:Virus-induced modification of the host cell is required for expression of the bacterial chloramphenicol acetyltransferase gene controlled by a late herpes simplex virus promoter (VP5). 299 49

trans-Acting regulatory components of herpes simplex virus were studied in a transient assay system by the analysis of expression of recombinant constructs which contain virus delayed-early (DE) or immediate-early (IE) upstream promoter-regulatory regions linked to the bacterial gene for chloramphenicol acetyltransferase (CAT). These recombinant CAT constructs were cotransfected into Vero cell cultures together with intact genes for the IE175K protein, the IE110K protein, or the late component, Vmw65. We demonstrate specific functional interactions between the trans-acting factors and their appropriate cis-acting regulatory signals. Thus, the IE175K protein stimulated expression only from the DE-CAT constructs, and the late Vmw65 protein stimulated expression only from the IE-CAT construct. Unexpectedly, however, the IE110K protein stimulated expression from both DE- and IE-CAT constructs. Furthermore, the IE175K protein inhibited both basal levels and IE110K- or Vmw65-activated levels of expression from its own promoter-regulatory region in the IE-CAT construct. These results provide direct evidence for a negative autoregulatory role of IE175K protein on its own expression at the transcriptional level and demonstrate differences in functional properties of the IE175K and IE110K proteins, which we speculate may reflect different mechanisms of action of the two proteins.
...
PMID:Three trans-acting regulatory proteins of herpes simplex virus modulate immediate-early gene expression in a pathway involving positive and negative feedback regulation. 299 28

A modular system for assaying the activity of transcriptional regulatory signals based on herpes simplex virus (HSV) promoter and terminator sequences linked to the bacterial chloramphenicol acetyltransferase (CAT) gene has been used to study activation of HSV immediate early (IE) gene expression. Insertion of the SV40 72 base pair (bp) repeat increased mRNA levels by 15-fold thus demonstrating the ability of the HSV IE promoter to respond to a heterologous enhancer. A fragment containing part of the intergenic region located between HSV-2 immediate early (IE) genes-3 and -4/-5 increased mRNA levels by 5-fold in response to transactivation by an HSV virion structural polypeptide. The HSV activator fragment increased mRNA levels by 2-fold in the absence of transactivation indicating that cellular proteins are involved in IE gene expression. From HSV-1/HSV-2 DNA sequence comparisons we previously proposed that a DNA sequence, consensus TAATGARAT, present upstream of all HSV-1 and HSV-2 IE genes was required for the co-ordinate induction of IE genes. We show here that a synthetic oligonucleotide containing TAATGARAT conferred the ability to stimulate CAT activity only on transactivation: two copies of TAATGARAT stimulated expression by 2-fold while six copies gave an 8-fold increase. This activation, which was not dependent on orientation of the TAATGARAT sequence, directly demonstrates that TAATGARAT is a component of the IE gene activation sequence.
...
PMID:A modular system for the assay of transcription regulatory signals: the sequence TAATGARAT is required for herpes simplex virus immediate early gene activation. 299 6

To study trans-activation of gene expression by murine cytomegalovirus (MCMV) immediate-early (IE) proteins, the IE coding region 1 (ie1), which encodes the 89,000-Mr IE phosphoprotein (pp89), was stably introduced into L cells. A cell line was selected and characterized that efficiently expressed the authentic viral protein. The pp89 that was constitutively expressed in L cells stimulated the expression of transfected recombinant constructs containing the bacterial chloramphenicol acetyltransferase (CAT) gene under the control of viral promoters. The regulatory function of the ie1 product was confirmed by transient expression assays in which MCMV IE genes were cotransfected into L cells together with recombinant constructs of the CAT gene. For CAT activation by the ie1 product, a promoter region was required, but there was no preferential activation of a herpes simplex virus type 1 delayed-early promoter. All plasmid constructs that contained the intact coding sequences for pp89 induced gene expression in trans. The MCMV enhancer region was not essential for the expression of a functional IE gene product, and testing of the cis-regulatory activity of the MCMV enhancer revealed a low activity in L cells. Another region transcribed at IE times of infection, IE coding region 2, was unable to induce CAT expression and also did not augment the functional activity of ie1 after cotransfection.
...
PMID:The 89,000-Mr murine cytomegalovirus immediate-early protein activates gene transcription. 300 59

We identified an Epstein-Barr virus (EBV) gene product which functions in transient-expression assays as a nonspecific trans activator. In Vero cells, cotransfection of the BglII J DNA fragment of EBV together with recombinant constructs containing the bacterial chloramphenicol acetyltransferase (CAT) gene gave up to a 100-fold increased expression of CAT activity over that in cells transfected with the recombinant CAT constructs alone. The BglII J fragment acted promiscuously, in that increased CAT synthesis was observed regardless of whether the promoter sequences driving the CAT gene were of EBV, simian virus 40, adenovirus, or herpes simplex virus origin. Cleavage of cloned BglII-J plasmid DNA before transfection revealed that activation was dependent upon the presence of an intact BMLF1 open reading frame. This was confirmed with subclones of BglII-J and with hybrid promoter-open reading frame constructs. This region of the genome is also present in the rearranged P3HR-1-defective DNA species, and defective DNA clones containing these sequences produced a similar activation of CAT expression in cotransfection experiments. The heterogeneous 45-60-kilodalton polypeptide product of BMLF1 may play an important regulatory role in expression of lytic-cycle proteins in EBV-infected lymphocytes.
...
PMID:Promiscuous trans activation of gene expression by an Epstein-Barr virus-encoded early nuclear protein. 301 81

To better define the activities on herpes simplex virus type 1 gene expression of temperature-sensitive and wild-type forms of the transcriptional regulatory protein ICP4, regulatory sequences from immediate-early, early, and late herpes simplex virus genes were fused to the gene for chloramphenicol acetyltransferase (CAT). These constructs were used in trans induction and cotransfection experiments with wild-type and temperature-sensitive mutant alleles of ICP4. The ICP4 genes used in this study were cloned from the KOS strain (wild type) and two phenotypically distinct temperature-sensitive ICP4 mutants, tsB32 and tsL14 (DeLuca et al., J. Virol. 52:767-776, 1984), both alone and in conjunction with three other immediate-early genes. The latter series of plasmids was used to assess the influence of additional immediate-early gene products on gene expression in the presence of a given ICP4 allele. The results of this study demonstrate that the phenotypes of these ICP4 mutants observed in cell culture at the nonpermissive temperature were determined in part by activities associated with the mutant ICP4 polypeptides and that these activities differed from those of wild-type ICP4. Low levels of wild-type ICP4 had a marginal but reproducible stimulatory effect on immediate-early CAT gene expression, especially the pIE4/5CAT chimera. This effect was diminished with increasing quantities of ICP4, suggesting an inhibitory role for the wild-type form of the protein. The ICP4 mutants had a strong stimulatory effect on immediate-early CAT expression, consistent with their phenotypes at 39 degrees C. The mutant forms of the ICP4 polypeptide differed in their ability to induce CAT activity from an early chimeric gene. Thus, the tsL14 form of ICP4 was effective in early gene induction (i.e., ptkCAT was induced), whereas the ICP4 derived from tsB32 was slightly inhibitory. Cotransfection of tsB32 ICP4 simultaneously with other immediate-early genes resulted in a marginal increase in ptkCAT induction. This induction was enhanced when the gene for ICP4 was inactivated by restriction enzyme cleavage, substantiating the inhibitory effect of the tsB32 form of ICP4. The two mutant ICP4 genes (tsB32 and tsL14) were unable to trans-activate either of the late CAT constructs (p5CAT and pL42CAT) tested. Cotransfecting tsL14 ICP4 with the other immediate-early genes resulted in activation of p5CAT but not pL42CAT. Taken together, these studies demonstrate that (i) low levels of wild-type ICP4 have stimulatory effect on immediate-early promoters and that higher concentrations of wild-type ICP4 have an inhibitory effect on these promoters, (ii) isolated mutant form of ICP4 exhibit activities that reflect the phenotypes of the mutants from which they were isolated, and (iii) immediate-early gene products other than ICP4 are involved in determining the distinct phenotypes of the two mutants at 39 degrees Celsius.
...
PMID:Activation of immediate-early, early, and late promoters by temperature-sensitive and wild-type forms of herpes simplex virus type 1 protein ICP4. 301 43

A detailed analysis of the expression of the bacterial chloramphenicol acetyltransferase gene controlled by the herpes simplex virus major capsid protein (VP5) promoter showed that this promoter can be functionally separated into an 80-base core region, which has the minimal information required to serve as a pol II promoter but which is not fully activated by viral superinfection or by cotransfections with plasmids bearing functional alpha (immediate-early) genes, and an approximately 100-base regulatory region upstream of the core, which allowed full induction of VP5 promoter-driven chloramphenicol acetyltransferase activity but which repressed the ability of the VP5 core promoter to be cis activated by the simian virus 40 enhancer. This was in distinct contrast to the situation with the alkaline exonuclease promoter (a model early promoter) and defined the regions of this promoter which can be used to study the interaction between viral promoters and putative regulatory proteins induced by viral infection.
...
PMID:A single regulatory region modulates both cis activation and trans activation of the herpes simplex virus VP5 promoter in transient-expression assays in vivo. 302 80

Expression of the early and late genes of herpes simplex virus type 1 (HSV-1) during infection of tissue culture cells requires the prior expression of the immediate early (IE) genes. The requirement for the product of IE gene 3, Vmw175, for the activation of early promoters has been revealed by studies with temperature-sensitive virus mutants. Recent experiments using transfection assays have shown that both Vmw175 and the product of IE gene 1, Vmw110, are involved in the transactivation of a variety of HSV-1 early promoters. This paper describes experiments which compared the activation of two early promoters [those of the glycoprotein gD and thymidine kinase (tk) genes] with that of a member of a later class of genes (the major capsid protein, VP5). Plasmids containing these promoters linked to the chloramphenicol acetyltransferase (CAT) gene were transfected into HeLa cells with plasmids containing one or more HSV-1 IE genes. Promoter activity was estimated by measurement of CAT activity in extracts of transfected cells. The gD and tk promoters were activated by both Vmw175 and Vmw110, and the combination of these two IE gene products resulted in very high levels of activation. Addition of further IE gene products did not result in any significant increase in the activation seen with the combination of Vmw175 and Vmw110. In contrast, the activation of the VP5 promoter brought about by the combination of Vmw175 and Vmw110 was relatively slight, but was increased further when plasmids containing IE gene 2, encoding Vmw63, were included in the transfection. These data suggest that Vmw63, like Vmw175 and Vmw110, is also involved in the activation of transcription from HSV-1 promoters. The effect of Vmw63 may be limited to the activation of a subset of HSV-1 genes.
...
PMID:The products of herpes simplex virus type 1 (HSV-1) immediate early genes 1, 2 and 3 can activate HSV-1 gene expression in trans. 302 36

Using a short-term cotransfection system with recombinant chloramphenicol acetyltransferase (CAT) target genes and intact genes for regulatory proteins, we previously demonstrated that expression from the promoter-regulatory region of the gene for the immediate-early 175,000-molecular-weight (IE175K) protein of herpes simplex virus type 1 was subject to trans-acting effects by three different virus-encoded components. In the present work we have attempted to delineate the upstream cis-acting requirements within the IE175K promoter-regulatory region for stimulation by the late structural protein Vmw65, stimulation by the IE110K protein, and repression by its own gene product, the IE175K protein. Our results augment previous reports of others by demonstrating that a construct containing only the single TAATGARAT consensus sequence, TAATGGAAT, between -115 and -106 was efficiently induced by Vmw65. Deletion to -108 effectively abolished the response to Vmw65. However, this latter construct remained responsive to IE110K stimulation and was induced as efficiently as the parental construct which contained sequences to -1900. Furthermore, not only basal levels of expression, but also Vmw65 activation of the parental construct and deletion mutants delta 380, delta 330, delta 300, and delta 160 and IE110K-activated expression of the delta 108 construct were all subject to dominant repression by the IE175K protein. Finally, we show that expression from each of the deletions was open to stimulation by linkage to the simian virus 40 enhancer region. Enhancer-stimulated expression from each construct, including the -108 deletion, was efficiently repressed by the IE175K protein. In contrast, expression from the simian virus 40 enhancer when linked to its own promoter was unaffected by IE175K. These results place sequence requirements for both IE110K stimulation and IE175K autoregulation within the minimal promoter region -108 to +30, separate from the major requirements for Vmw65 activation located further upstream.
...
PMID:Comparison of upstream sequence requirements for positive and negative regulation of a herpes simplex virus immediate-early gene by three virus-encoded trans-acting factors. 302 97


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>

---