Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Skeletal alpha-actin mRNA increases in the adult heart during cardiac hypertrophy after the imposition of hemodynamic overload/aortic restriction. 3,3',5-Triiodo-L-thyronine (T3) elicits a cardiac response similar to the effect of prolonged exercise and was recently shown to cause a rapid increase in the amount of skeletal alpha-actin mRNA in hearts from normal and hypophysectomized animals. We used transient transfection analysis to show that T3 induces the expression of the native skeletal alpha-actin promoter between nucleotide positions -2000 and +239 linked to the chloramphenicol acetyltransferase reporter gene in COS-1 fibroblasts and myogenic C2C12 cells. This T3 (10-100 nM)-induced transcriptional activation is dependent on the expression of the thyroid hormone receptors from transfected alpha 1 and beta 1 c-erbA complementary DNA expression vectors. Electrophoretic mobility shift assays were used to identify a thyroid hormone response element (TRE) in the human skeletal alpha-actin gene. This TRE is located between nucleotide positions -173 and -149 with respect to the start of transcription at +1 (5' TGGTCAACGCAGGGGACCCGGGCGG 3'). Electrophoretic mobility shift assay experiments showed that the putative skeletal alpha-actin TRE and defined rodent growth hormone TREs (that bind thyroid hormone receptors in vitro and in vivo) interacted with an identical nuclear factor in vitro in muscle cells that was developmentally regulated during myogenesis. Transient transfection analysis utilizing 5' unidirectional deletions of the skeletal alpha-actin promoter indicated that cis-acting sequences between nucleotide positions -432 and -153, which encompassed the TRE, were required for T3/thyroid hormone receptor-dependent trans-activation in vivo. Furthermore, we demonstrated that the skeletal alpha-actin TRE is juxtaposed next to SRF and SpI binding sites, at its 5' and 3' flanks, respectively. It is also surrounded by sequences densely populated by other SpI, SRF, and CTF binding sites. In conclusion, these results indicate that T3-induced increases in alpha-actin mRNA in animals are mediated by a direct transcriptional mechanism that may involve interactions with ubiquitous proteins.
...
PMID:The human skeletal alpha-actin promoter is regulated by thyroid hormone: identification of a thyroid hormone response element. 131 69

Oncogenic activation of ras results in changes in the transcription of several genes leading to uncontrolled cell growth. In this paper, we demonstrate that transformation of fibroblast cells by the ras oncogene leads to transcriptional repression of the smooth muscle alpha-actin promoter. Transient transfection analysis of plasmids containing the 5' upstream region of the human alpha-actin gene fused to human growth hormone or bacterial chloramphenicol acetyltransferase coding sequences into Rat-2 and ras-transformed Rat-2 (HO6) cells indicates that alpha-actin promoter is repressed in ras-transformed cells. In addition, stable rat fibroblast cell lines expressing human growth hormone or beta-galactosidase under the control of alpha-actin promoter exhibit repressed reporter gene activity following transformation by the ras oncogene. alpha-Actin promoter-driven beta-galactosidase activity is derepressed in revertants of ras-transformed stable cell lines. This revertant cell line expresses elevated levels of ras p21 protein and is resistant to retransformation by Ki and Ha-ras oncogenes. The revertant may have either a defective target protein whose activity is essential for the transforming activity of ras or an activated tumor suppressor gene which can suppress the activity of ras. These results indicate that smooth muscle alpha-actin promoter activity is a sensitive marker to follow phenotypic changes following transformation by ras and subsequent reversion. The advantages of this alpha-actin promoter-reporter gene assay system to screen for drugs that inhibit the transforming activity of ras, either directly or indirectly, are discussed.
...
PMID:Regulation of smooth muscle alpha-actin promoter in ras-transformed cells: usefulness for setting up reporter gene-based assay system for drug screening. 145 76

The promoter regions of the chicken skeletal muscle alpha-actin (alpha sk-actin) and the cytoplasmic beta-actin genes were linked to the bacterial chloramphenicol acetyltransferase (CAT) gene. Replication-competent retroviral vectors were used to introduce these two actin/CAT cassettes into the chicken genome. Chickens infected with retroviruses containing the alpha sk-actin promoter expressed high levels of CAT activity in striated muscle (skeletal muscle and heart); much lower levels of CAT activity were produced in the other nonmuscle tissues. In contrast, chickens infected with retroviruses containing the beta-actin promoter linked to the CAT gene expressed low levels of CAT activity in many different tissue types and with no discernible tissue specificity. Data are presented to demonstrate that the high levels of CAT activity that were detected in the skeletal muscle of chickens infected with the retrovirus containing the alpha sk-actin promoter/CAT cassette were not due to preferential infectivity, integration, or replication of the retrovirus vector in the striated muscles of these animals.
...
PMID:Appropriate in vivo expression of a muscle-specific promoter by using avian retroviral vectors for gene transfer [corrected]. 163 16

We have identified and functionally characterized DNA sequences that regulate the expression of the human ventricular/slow twitch isoform of myosin alkali light chain (VLC1) gene. By using primer extension and S1 nuclease mapping techniques, we have shown that the VLC1 gene is transcribed from the identical site in the ventricular and slow twitch skeletal muscles. Comparison of the VLC1 sequences from +1 to -1296 in the genes for human and mouse showed that the 5'-proximal flanking region, up to about 220 nucleotides, was highly conserved (83% homology). To determine the location of sites that may be important for the function of the VLC1 promoter, a series of transient expression vectors containing progressive deletions of the VLC1 gene 5'-flanking sequence fused to the bacterial chloramphenicol acetyltransferase (CAT) gene was introduced into myogenic and nonmyogenic cells. Deletion mutagenesis of sequences between -357 and +40 revealed the presence of positive and negative activity in all the cells tested. We demonstrated that the minimal promoter sequence required to generate muscle cell-specific expression is the region between -94 to -64 upstream from the cap site and a sequence element located between -107 and -94 was found to have a positive effect in both myogenic cells and nonmyogenic cells. These two proximal regions located between -107 and -64 appear to act together to determine the cell type-specific high level expression of the VLC1 gene in muscle cells. Competition gel retardation assays revealed that the CArG sequence located between -96 and -87 interacts specifically with nuclear extracts from myogenic and nonmyogenic cells and compete for binding with the CArG sequence present in the human cardiac alpha-actin gene and with the serum response element of the c-fos gene. These results strongly suggested that similar, if not identical, the CArG box binding proteins interact with the functionally different promoter element in the VLC1, cardiac alpha-actin, and c-fos genes.
...
PMID:Functional identification of the transcriptional regulatory elements within the promoter region of the human ventricular myosin alkali light chain gene. 169 44

To examine the molecular mechanisms by which mechanical stimuli induce cardiac hypertrophy and specific gene expression, we cultured rat neonatal cardiocytes in deformable dishes and imposed an in vitro mechanical load by stretching the adherent cells. Myocyte stretching increased total cell RNA content and mRNA levels of c-fos and skeletal alpha-actin. Nuclear run-off transcription assay revealed that this increase in c-fos mRNA level by stretching at least partially reflects changes in the transcriptional status. The transfected chloramphenicol acetyltransferase gene linked to upstream sequences of the fos gene indicated that sequences containing a serum response element were required for efficient transcription by stretching and that sequences containing a cAMP/calcium response element might not be involved in the c-fos response to myocyte stretching. The accumulation of c-fos mRNA by stretching was suppressed by protein kinase C inhibitors at the transcriptional level and inhibited markedly by down-regulation of protein kinase C. Moreover, myocyte stretching increased inositol phosphate levels, and activation of protein kinase C by phorbol esters stimulated the expression of c-fos and skeletal alpha-actin genes. These findings suggest that mechanical stimuli (myocyte stretching) might directly induce cardiac hypertrophy and specific gene expression possibly via protein kinase C activation.
...
PMID:Mechanical loading stimulates cell hypertrophy and specific gene expression in cultured rat cardiac myocytes. Possible role of protein kinase C activation. 170 36

We have isolated an avian muscle cell line (QM) which has the essential features of established mammalian muscle cell lines. The experiments reported here were undertaken to determine the suitability of QM cells for the introduction and analysis of cloned transgenes. The promoter of the cardiac troponin T (cTNT) gene has been previously shown to contain sequence elements which govern muscle-specific expression of the chloramphenicol acetyltransferase (CAT) gene in transiently transfected primary cell cultures. We show here that QM cells stably harboring cTNT promoter-CAT fusion genes up-regulate CAT expression in concert with myogenic differentiation, and that as few as 110 upstream nucleotides are sufficient for such differentiation-dependent regulation. In addition, both transient and stable transfection experiments demonstrate that differentiated QM cells possess trans-acting factors necessary for the expression of the skeletal alpha-actin promoter, despite the absence of mRNA or protein product from the endogenous sarcomeric actin genes in these cells. Finally, to follow the developmental potential of QM cells in vivo, we created a clone, QM2ADH, which constitutively expresses the histochemical marker transgene encoding Drosophila alcohol dehydrogenase. When surgically inserted into the limb buds of developing chick embryos, QM2ADH cells are incorporated into endogenous developing muscles, indicating that QM cells are capable of recognizing and responding to host cues governing muscle morphogenesis. Thus, QM cells are versatile as recipients of transgenes for the in vitro and in vivo analysis of molecular events in muscle development.
...
PMID:Transgene expression in the QM myogenic cell line. 198 14

Recently, site-directed mutagenesis uncovered four positive cis-acting elements in the 5' promoter region of the chicken skeletal alpha-actin gene that directs myogenic tissue-restricted expression. In this study, interactions between the four promoter sites were examined by means of a series of insertion mutations that increased the linker region between adjacent elements by roughly half or complete DNA helical turns. Unexpectedly, transcriptional activity for all three sets of linker mutants, as assayed with a chloramphenicol acetyltransferase reporter gene, was found to vary in a fashion resembling a damped sinusoid with a period of roughly 10 base pairs, where the sinusoidal maxima appeared when length was increased by half-integral number of helix turns. We present a model which states that in the undistorted wild-type 5' flanking sequence, linker domains position each of the four promoter sites on the helix face opposite that of its immediate neighbors; when any of the three linkers is increased by approximately a half-integral number of helix turns, pairs of neighboring promoter sites are brought into alignment. We propose that this is the required orientation for inducing skeletal muscle-specific promoter activity, achieved in the wild-type promoter as a result of protein-induced torsional deformation.
...
PMID:Phased cis-acting promoter elements interact at short distances to direct avian skeletal alpha-actin gene transcription. 199 31

We have determined the nucleotide (nt) sequence of 5.5 kb including the 5' flanking, first untranslated exon and first intron regions of the human smooth muscle (SM) (aortic type) alpha-actin-(Sm alpha A)- encoding gene. The promoter region and a part of the first intron show remarkably high sequence conservation with equivalent regions of the chicken gene, and contain multiple transcriptional regulatory elements. From transient chloramphenicol acetyltransferase gene (cat) expression assays in SM cells, a DNA fragment from nt -123 to +49 containing two CArG boxes showed strong positive promoter activity, whereas a far upstream region from nt -253 to -124 showed a negative effect. The conserved region in the first intron also contains the CArG box and showed an enhancer activity. Therefore, the human SM alpha A gene is controlled under positive and negative mechanisms.
...
PMID:Transcriptional regulatory elements in the 5' upstream and first intron regions of the human smooth muscle (aortic type) alpha-actin-encoding gene. 202 39

The myosin light chain (MLC) 1/3 enhancer (MLC enhancer), identified at the 3' end of the skeletal MLC1/3 locus, contains a sequence motif that is homologous to a protein-binding site of the skeletal muscle alpha-actin promoter. Gel shift, competition, and footprint assays demonstrated that a CArG motif in the MLC enhancer binds the proteins MAPF1 and MAPF2, previously identified as factors interacting with the muscle regulatory element of the skeletal alpha-actin promoter. Transient transfection assays with constructs containing the chloramphenicol acetyltransferase reporter gene demonstrated that a 115-bp subfragment of the MLC enhancer is able to exert promoter activity when provided with a silent nonmuscle TATA box. A point mutation at the MAPF1/2-binding site interferes with factor binding and abolishes the promoter activity of the 115-bp fragment. The observation that an oligonucleotide encompassing the MAPF1/2 site of the MLC enhancer alone cannot serve as a promoter element suggests that additional factor-binding sites are necessary for this function. The finding that MAPF1 and MAPF2 recognize similar sequence motifs in two muscle genes, simultaneously activated during muscle differentiation, implies that these factors may have a role in coordinating the activation of contractile protein gene expression during myogenesis.
...
PMID:The myosin light chain enhancer and the skeletal actin promoter share a binding site for factors involved in muscle-specific gene expression. 204 75

The chicken skeletal alpha-actin gene promoter region provides at least a 75-fold-greater transcriptional activity in muscle cells than in fibroblasts. The cis-acting sequences required for cell type-restricted expression within this 200-base-pair (bp) region were elucidated by chloramphenicol acetyltransferase assays of site-directed Bg/II linker-scanning mutations transiently transfected into primary cultures. Four positive cis-acting elements were identified and are required for efficient transcriptional activity in myogenic cells. These elements, conserved across vertebrate evolution, include the ATAAAA box (-24 bp), paired CCAAT-box-associated repeats (CBARs; at -83 bp and -127 bp), and the upstream T+A-rich regulatory sequence (at -176 bp). Basal transcriptional activity in fibroblasts was not as dependent on the upstream CBAR or regions of the upstream T+A-rich regulatory sequence. Transfection experiments provided evidence that positive regulatory factors required for alpha-actin expression in fibroblasts are limiting. In addition, negative cis-acting elements were detected and found closely associated with the G+C-rich sequences that surround the paired CBARs. Negative elements may have a role in restricting developmentally timed expression in myoblasts and appear to inhibit promoter activity in nonmyogenic cells. Cell type-specific expression of the skeletal alpha-actin gene promoter is regulated by combinatorial and possibly competitive interactions between multiple positive and negative cis-acting elements.
...
PMID:A combination of closely associated positive and negative cis-acting promoter elements regulates transcription of the skeletal alpha-actin gene. 230 53


1 2 3 Next >>