Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.3.1.28 (chloramphenicol acetyltransferase)
 5,100 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The 5' flanking region of the mouse renin genes (Ren-1d and Ren-2d) contains two motifs that are homologous to known negative regulatory elements (NREs). Ren-2d has a 150-base-pair (bp) insertion 5' to the upstream putative NRE (NRE-1), which is lacking in Ren-1d. We tested the functionality of these sequences by using site-directed mutagenesis to delete individually each putative NRE from Ren-1d and to delete the 150-bp insertion from Ren-2d. We examined the effect of these mutations on the expression of the reporter gene chloramphenicol acetyltransferase, which was expressed from a truncated thymidine kinase promoter fused to the renin regulatory region. This plasmid was transfected into human choriocarcinoma JEG-3 cells. Only the upstream NRE (positions -619 to -597) was found to be functional in Ren-1d. The deletion of a 150-bp insertion from Ren-2d resulted in the suppression of chloramphenicol acetyltransferase activity to the level of Ren-1d expression. These data suggest that the upstream NRE that is functional in Ren-1d, but not in Ren-2d, may be partly responsible for differential expression of the renin genes in various tissues. The molecular mechanism of the NRE was examined by studying its interaction with nuclear proteins in submandibular gland and JEG-3 cells by gel-mobility-shift assays. Specific nuclear protein binding was observed only to the upstream NRE and the molecular mass of this protein was approximately 72 kDa as determined by Southwestern blot analysis. Thus our results suggest that both Ren-1d and Ren-2d conserve a cis-acting NRE in the 5' flanking region. In Ren-1d, this NRE could bind a specific nuclear protein resulting in the inhibition of Ren-1d expression in these tissues. On the other hand, the NRE in Ren-2d is nonfunctional due to interference by an adjacent 150-bp insertion.
 ...
PMID:Identification of a negative regulatory element involved in tissue-specific expression of mouse renin genes. 173 3

Secretion of haemolysin (HlyA) is secA independent, but depends upon two accessory membrane proteins, HlyB and HlyD, encoded by the hly determinant. A fourth (cytoplasmic) protein, HlyC, is required to activate HlyA post-translationally, but has no role in export. Deletion studies have previously shown that the HlyA molecule contains a targeting signal close to the C-terminus which specifically directs its secretion to the medium. This targeting signal has been variously located within the terminal 27, 53, 60 or 113 amino acids. In this paper, we have sought to confirm the presence of a C-terminal targeting signal and to analyse the specificity of the Hly transport system through fusion of C-terminal fragments of HlyA to heterologous polypeptides. A C-terminal fragment (23 kDa) of HlyA, when fused at the C-terminus, efficiently promoted the secretion of the eukaryotic protein prochymosin (PCM) to the medium via HlyB and HlyD. This result is in contrast to previous findings that prochymosin, preceded by the alkaline phosphatase signal sequence, cannot be translocated across the Escherichia coli inner membrane. The HlyA targeting domain was also used to secrete to the medium varying portions of chloramphenicol acetyltransferase (CAT) and 98 per cent of the beta-galactosidase (LacZ) molecule (both E. coli cytoplasmic proteins). In the case of the PCM and CAT fusions the efficiency of secretion was reduced as the proportion of the PCM and CAT molecule increased. This result is consistent with inhibition of secretion through the irreversible folding of the larger passenger protein fragments, or the occlusion of the HlyA targeting signal by upstream sequences. Analysis of the nature of the C-terminal domain promoting secretion of prochymosin, demonstrated that shortening the signal domain from 218 to 113 amino acids significantly reduced the efficiency of secretion. This result may also reflect the importance of maintaining an independently folded signal motif well separated from a passenger domain.
 ...
PMID:Analysis of the haemolysin transport process through the secretion from Escherichia coli of PCM, CAT or beta-galactosidase fused to the Hly C-terminal signal domain. 179 66

A chimeric gene construct containing a bean chalcone synthase (CHS) promoter fused to the chloramphenicol acetyltransferase (CAT) reporter gene was strongly expressed when electroporated into alfalfa protoplasts that were then exposed to a fungal elicitor. Low concentrations (5 x 10(-6) to 10(-4) M) of exogenously applied trans-cinnamic acid (CA), the first intermediate of the phenylpropanoid pathway, slightly stimulated elicitor-induced CAT expression, whereas high concentrations (greater than 10(-4) M) severely reduced expression to below the levels observed in the absence of elicitor. In contrast, trans-p-coumaric acid (4-CA, the second intermediate in the pathway) stimulated expression from the CHS promoter up to 4.5-fold at 5 x 10(-4) M. Expression of CAT driven by the promoters of other elicitor-inducible defense response genes was not markedly affected by CA or 4-CA. Stimulation of CHS promoter expression by low concentrations of CA and 4-CA was completely abolished by 5' deletion to position -130, but not -174. When the -180 to -130 region of the CHS15 promoter was coelectroporated into elicited protoplasts on a separate plasmid along with the intact -326 CHS-CAT construct, the decreased CAT expression as a function of CA or 4-CA concentration was consistent with the coelectroporated sequence competing in trans with the intact promoter for the binding of a factor(s) involved in the up regulation of CHS transcription by 4-CA and low concentrations of CA. Our data support the hypothesis that phenylpropanoid compounds may act as natural and specific regulators of plant gene expression and define the location of a cis-acting element in the CHS15 promoter involved in the induction by phenylpropanoid pathway intermediates.
 ...
PMID:Phenylpropanoid pathway intermediates regulate transient expression of a chalcone synthase gene promoter. 182 Aug 22

Human leukosialin (CD43) is a major sialoglycoprotein expressed on leukocytes and platelets. In order to investigate the transcriptional regulation of this gene, we have isolated a genomic DNA of 12 kilobases in size that includes the 5'-flanking sequence. Comparison of the genomic and cDNA sequences revealed that the leukosialin gene consists of two exons, and that its entire translation product is encoded in the second exon. The transcriptional start site was determined by primer extension analysis in human T-cell line Jurkat. No canonical TATA or CAAT boxes were found in the prospected upstream region, but a guanine-rich region was observed on the sense strand. To localize the transcriptional regulatory region of this gene, various regions of 5' sequences were fused to the chloramphenicol acetyltransferase (CAT) gene, and transient expression assays were conducted in Jurkat cells. We employed the polymerase chain reaction to generate a series of clones containing 5' sequences of the leukosialin gene using primer sequences based on the genomic sequence. This strategy enabled us to narrow the search for a transcriptional regulatory element. In addition, we introduced site-directed mutations in the regulatory region by polymerase chain reaction to define it in detail. These studies showed that the sequence from -53 to -40 base pairs 5' to the transcriptional start site is critically involved in leukosialin expression. This sequence, 5'GGGTGGGTGGAGCC3', represents a novel promoter sequence which has not been reported in the promoters for other molecules expressed in T-lymphocytes.
 ...
PMID:A short, novel promoter sequence confers the expression of human leukosialin, a major sialoglycoprotein on leukocytes. 182 22

The mRNA encoding the sarcoplasmic reticulum (SR) Ca2+ ATPase is highly influenced by thyroid hormone (T3) in the hearts of intact animals. We show here that this effect of T3 can be mimicked in primary neonatal rat cardiocytes, both in serum-containing and in serum-free media; the expression of SR Ca2+ ATPase mRNA is myocyte-specific and is also modulated by retinoic acid (RA). RA also induces myosin heavy chain (MHC) alpha-mRNA in this system. The induction of Ca2+ ATPase mRNA is sensitive to T3 (EC50 approximately 30 pM) and less sensitive to RA (EC50 approximately 2 nM). Transient transfection experiments utilizing various segments of the Ca2+ATPase promoter fused to the reporter gene chloramphenicol acetyltransferase (CAT) indicate a minimal thyroid hormone response element (TRE) between nucleotides -262 and -322, while sequences between -322 and -559 are required for maximal trans-activation. RA is not able to regulate these constructs. Likewise, a clear effect of T3 but no effect of RA was observed when the CAT gene was driven by a TRE derived from the rat alpha-MHC gene. In contrast, CAT expression was induced by either hormone when placed under the control of a synthetic palindromic TRE. Taken together, these results indicate that T3 and RA induce gene expression in primary cardiac myocytes, but through distinct response elements and/or mechanisms.
 ...
PMID:Influence of thyroid hormone and retinoic acid on slow sarcoplasmic reticulum Ca2+ ATPase and myosin heavy chain alpha gene expression in cardiac myocytes. Delineation of cis-active DNA elements that confer responsiveness to thyroid hormone but not to retinoic acid. 182 23

We have used a transient expression assay in aleurone protoplasts of barley to delineate hormone response elements of the abscisic acid (ABA)-responsive rice gene Rab16A and of the gibberellin A3 (GA3)-responsive barley alpha-amylase gene Amy 1/6-4. Our approach used transcriptional fusions between their 5' upstream sequences and a bacterial chloramphenicol acetyltransferase reporter gene. A chimeric promoter containing six copies of the -181 to -171 region of Rab 16A fused to a minimal promoter conferred ABA-responsive expression on the reporter gene. Transcription from this ABA response element (GTACGTGGCGC) was unaffected by GA3. A chimeric promoter containing six copies of the -148 to -128 sequence of Amy 1/6-4 fused to the minimal promoter conferred GA3-responsive expression on the reporter gene. Transcription from this GA3 response element (GGCCGATAACAAACTCCGGCC) was repressed by ABA. The effect on transcription from both hormone response elements was orientation-independent, indicating that they function as inducible enhancers in their native genes.
 ...
PMID:cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid. 183 Dec 69

We have employed transient expression assays to analyze the sequences that direct c-mos transcription in mouse oocytes. Plasmids containing the chloramphenicol acetyltransferase (CAT) gene fused to either a 2.4-kb or a 731-bp fragment from the 5'-flanking region of c-mos produced similar levels of CAT activity when injected into nuclei of growing oocytes. BAL 31 deletions revealed that sequences up to 20 bp upstream of the major transcription start site could be removed without any significant loss of CAT activity. Promoter activity only decreased when these deletions closely approached the transcription start site, which was mapped at 53 nucleotides upstream of the first ATG in the c-mos open reading frame. On the other hand, deletion of sequences within 20 nucleotides downstream of the transcription initiation site resulted in a 10-fold reduction in CAT expression. A similar decrease in promoter activity was observed as a result of point mutations in these 5' untranslated sequences. Thus, sequences immediately downstream of the transcription start site, including a consensus sequence (PyPyCAPyPyPyPyPy) present in the initiator elements of several genes, appear to regulate c-mos expression in mouse oocytes. Reverse transcription-polymerase chain reaction analysis of RNA from injected oocytes showed that this regulation is manifest at the transcriptional level. Expression of c-mos in mouse oocytes thus appears to be directed by a simple promoter consisting only of sequences immediately surrounding the transcription start site, including an initiator element in the untranslated leader.
 ...
PMID:c-mos expression in mouse oocytes is controlled by initiator-related sequences immediately downstream of the transcription initiation site. 183 32

In cultured mammalian cells, foreign DNA can be integrated into the host genome. Foreign DNA is frequently de novo methylated in specific patterns with successive cell generations. The sequence-specific methylation of promoter sequences in integrated foreign DNA is associated with the long-term inactivation of eukaryotic genes. We have now extended these experiments to studies on transgenic mice. As in previous work, a construct (pAd2E2AL-CAT) has been used which consists of the late E2A promoter of adenovirus type 2 (Ad2) DNA fused to the prokaryotic gene for chloramphenicol acetyltransferase (CAT). This construct has been integrated in the non-methylated in the 5'-CCGG-3' premethylated form in the genomes of transgenic mice. DNA from various organs was analyzed by HpaII/MspI cleavage to assess the state of methylation in 5'-CCGG-3' sequences. The results demonstrate that the transgenic construct is in general stable. Non-methylated constructs have remained partly non-methylated for four generations or can become de novo methylated at all or most 5'-CCGG-3' sequences in the founder animal. Preimposed patterns of 5'-CCGG-3' methylation have been preserved for up to four generations beyond the founder animal. In the testes of two different founder animals and two F1 males, the transgenic DNA has become demethylated by an unknown mechanism. In all other organs, the transgenic DNA preserves the preimposed 5'-CCGG-3' methylation pattern. In the experiments performed so far we have not observed differences in the transmission of methylation patterns depending on whether the transgene has been maternally or paternally inherited. The 5'-CCGG-3' premethylated transgene does not catalyze CAT activity in several organs, except in one example of the testes of an animal in which the transgenic construct has become demethylated. In contrast, when the nonmethylated construct has been integrated and remained largely non-methylated, CAT activity has been detected in extracts from some of the organs.
 ...
PMID:Persistence or loss of preimposed methylation patterns and de novo methylation of foreign DNA integrated in transgenic mice. 183 54

We have isolated non-globin cDNA clones specific for erythroid differentiation from K562 human erythroleukemia cells and have identified those that may regulate globin gene transcription. A cDNA library was constructed from K562 cells induced by hemin for production of embryonic and fetal hemoglobins and screened against cDNA from uninduced K562 cells. Full-length clones specific for induced K562 cells were ligated into a eukaryotic expression vector and transfected into HeLa cells to allow for production of the corresponding coded polypeptide. The ability to increase epsilon- or gamma-globin promoter activity was identified using cotransfection with a second vector containing a globin gene promoter fused to a reporter gene. Six of the induced K562-specific clones exhibited the ability to increase the levels of the reporter genes, bacterial chloramphenicol acetyltransferase and human growth hormone. Sequencing analyses of these clones indicated that five were homologous to ferritin heavy and light chains and one had no homology with known DNA or protein sequences. The ferritin light chain cDNA had the greatest effect on globin gene promoter activation, increasing the gamma-globin promoter activity by 6-8-fold. The activation of the globin gene promoter in the absence of globin gene translation suggests that ferritin (or iron) may have a direct role in globin gene transcription. The subtractive library cloning strategy has enabled us to isolate cDNA clones that activate specific gene promoter without the requirement of direct DNA binding. This approach may allow further identification of the genes encoding proteins that are involved in the control of erythropoiesis.
 ...
PMID:Activation of globin gene expression by cDNAs from induced K562 cells. Evidence for involvement of ferritin in globin gene expression. 184 May 94

Legumin subunits are synthesized as precursor polypeptides and are transported into protein storage vacuoles in field bean cotyledons. We expressed a legumin subunit in yeast and found that in these cells it is also transported into the vacuoles. To elucidate vacuolar targeting information, we constructed gene fusions of different legumin propolypeptide segments with either yeast invertase or chloramphenicol acetyltransferase as reporters for analysis in yeast or plant cells, respectively. In yeast, increasing the length of the amino-terminal segment increased the portion of invertase directed to the vacuole. Only the complete legumin alpha chain (281 amino acids) directed over 90% to the vacuole. A short carboxy-terminal legumin segment (76 amino acids) fused to the carboxy terminus of invertase also efficiently targeted this fusion product to yeast vacuoles. With amino-terminal legumin-chloramphenicol acetyltransferase fusions expressed in tobacco seeds, efficient vacuolar targeting was obtained only with the complete alpha chain. We conclude that legumin contains multiple targeting information, probably formed by higher structures of relatively long peptide sequences.
 ...
PMID:Different legumin protein domains act as vacuolar targeting signals. 184 24


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>