Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:2.3.1.184 (
LasR
)
897
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Regulation of expression of bioluminescence from the Vibrio fischeri lux regulon in Escherichia coli is a consequence of a unique form of positive feedback superimposed on a poorly defined cis-acting repression mechanism. The lux regulon consists of two divergently transcribed operons. The leftward operon contains only a single gene, luxR, which encodes a
transcriptional activator
protein. The rightward operon contains luxI, which together with luxR and the 218 base pairs separating the two operons comprises the primary regulatory circuit, and the five structural genes, luxC, luxD, luxA, luxB and luxE, which are required for the bioluminescence activity. Transcription of luxR from PL is stimulated by binding of the E. coli crp gene product to the sequence TGTGACAAAAATCCAA upstream of the presumed promoter. Binding of pure E. coli CAP protein in a cAMP-dependent reaction to the V. fischeri lux regulatory region has been demonstrated by in vitro footprinting. The luxI gene product is an enzyme which catalyses a condensation reaction of cytoplasmic substrates to yield the autoinducer, N-(3-oxo-hexanoyl) homoserine lactone. Accumulation of autoinducer, which is freely diffusible, results in formation of a complex with LuxR. The complex binds to the sequence ACCTGTAGGATCGTACAGGT upstream of PR to stimulate transcription of the rightward operon. Increased transcription from PR should yield increased levels of
LuxI
and higher levels of autoinducer which would further activate LuxR. The LuxR binding site is also a LexA binding site, as demonstrated by in vitro footprinting. Basal transcription from both PL and PR is repressed by sequences within the luxR coding region.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Control of the lux regulon of Vibrio fischeri. 218 99
In recent years it has become clear that the production of N-acyl homoserine lactones (N-AHLs) is widespread in Gram-negative bacteria. These molecules act as diffusible chemical communication signals (bacterial pheromones) which regulate diverse physiological processes including bioluminescence, antibiotic production, plasmid conjugal transfer and synthesis of exoenzyme virulence factors in plant and animal pathogens. The paradigm for N-AHL production is in the bioluminescence (lux) phenotype of Photobacterium fischeri (formerly classified as Vibrio fischeri) where the signalling molecule N-(3-oxohexanoyl)-L-homoserine lactone (OHHL) is synthesized by the action of the
LuxI protein
. OHHL is thought to bind to the LuxR protein, allowing it to act as a positive
transcriptional activator
in an autoinduction process that physiologically couples cell density (and growth phase) to the expression of the bioluminescence genes. Based on the growing information on
LuxI
and LuxR homologues in other N-AHL-producing bacterial species such as Erwinia carotovora, Pseudomonas aeruginosa, Yersinia enterocolitica, Agrobacterium tumefaciens and Rhizobium leguminosarum, it seems that analogues of the P. fischeri lux autoinducer sensing system are widely distributed in bacteria. The general physiological function of these simple chemical signalling systems appears to be the modulation of discrete and diverse metabolic processes in concert with cell density. In an evolutionary sense, the elaboration and action of these bacterial pheromones can be viewed as an example of multicellularity in prokaryotic populations.
...
PMID:The bacterial 'enigma': cracking the code of cell-cell communication. 747 57
In Pseudomonas aeruginosa PAO1, expression of elastase is dependent upon an interaction between the positive
transcriptional activator
LasR
and the auto-inducer molecule N-(3-oxododecanoyl)-L-homoserine lactone (OdDHL), the synthesis of which is directed by
LasI
. Previously we have shown that in PAN067, an elastase-negative mutant of PAO1, elastase production can be restored to some extent by addition of exogenous N-(3-oxohexanoyl)-L-homoserine lactone (OHHL). Here we report that PAN067 is also defective in the production of alkaline protease, haemolysin, cyanide, pyocyanin and autoinducer(s). As neither addition of exogenous OdDHL nor introduction of lasR restored PAN067 to the parental phenotype, we sought to complement PAN067 with PAO1 DNA. From a cosmid library, a 2 kb DNA fragment was identified which re-established production of autoinducer(s) and exoproducts in PAN067. From the nucleotide sequence of this fragment, two genes termed rhIR and rhII were identified. RhII is responsible for autoinducer synthesis and shares 31% homology with
LasI
; RhIR has been previously identified in P. aeruginosa strain DSM2659 as a regulator of rhamnolipid biosynthesis and shares 28% identity with
LasR
. These data provide clear evidence that multiple families of quorum-sensing modulons interactively regulate gene expression in P. aeruginosa.
...
PMID:Multiple homologues of LuxR and LuxI control expression of virulence determinants and secondary metabolites through quorum sensing in Pseudomonas aeruginosa PAO1. 749 82
Pseudomonas aeruginosa produces a spectrum of exoproducts many of which have been implicated in the pathogenesis of human infection. Expression of some of these factors requires cell-cell communication involving the interaction of a small diffusible molecule, an "autoinducer," with a positive
transcriptional activator
. In P. aeruginosa PAO1,
LasI
directs the synthesis of the autoinducer N-(3-oxododecanoyl)-L-homoserine lactone (OdDHL), which activates the positive
transcriptional activator
,
LasR
. Recently, we have discovered a second signaling molecule-based modulon in PAO1, termed vsm, which contains the genes vsmR and vsmI. Using HPLC, mass spectrometry, and NMR spectroscopy we now establish that in Escherichia coli, VsmI directs the synthesis of N-butanoyl-L-homoserine lactone (BHL) and N-hexanoyl-L-homoserine lactone (HHL). These compounds are present in the spent culture supernatants of P. aeruginosa in a molar ratio of approximately 15:1 and their structures were unequivocally confirmed by chemical synthesis. Addition of either BHL or HHL to PAN067, a pleiotropic P. aeruginosa mutant unable to synthesize either of these autoinducers, restored elastase, chitinase, and cyanide production. In E. coli carrying a vsmR/vsmI'::lux transcriptional fusion, BHL and HHL activated VsmR to a similar extent. Analogues of these N-acyl-L-homoserine lactones in which the N-acyl side chain has been extended and/or oxidized at the C-3 position exhibit substantially lower activity (e.g., OdDHL) or no activity (e.g., dDHL) in this lux reporter assay. These data indicate that multiple families of quorum sensing modulons interactively regulate gene expression in P. aeruginosa.
...
PMID:Multiple N-acyl-L-homoserine lactone signal molecules regulate production of virulence determinants and secondary metabolites in Pseudomonas aeruginosa. 756 46
In Vibrio fischeri, the autoinducer N-3-oxohexanoyl-L-homoserine lactone (AI-1) governs the cell density-dependent induction of the luminescence operon via the LuxR
transcriptional activator
. The synthesis of AI-1 from bacterial metabolic intermediates is dependent on luxI. Recently, we found a second V. fischeri autoinducer molecule, N-octanoyl-L-homoserine lactone (AI-2), that in E. coli also activates the luminescence operon via LuxR. A locus independent of luxI was identified as being required for AI-2 synthesis. This 2.7-kb ain (autoinducer) locus was characterized by transposon insertion mutagenesis, deletion and complementation analysis, and DNA sequencing. A single 1,185-bp gene, ainS, was found to be the sole exogenous gene necessary for the synthesis of AI-2 in Escherichia coli. In addition, a V. fischeri ainS mutant produced AI-1 but not AI-2, confirming that in its native species ainS is specific for the synthesis of AI-2. ainS is predicted to encode a 45,580-Da protein which exhibits no similarity to
LuxI
or to any of the
LuxI
homologs responsible for the synthesis of N-acyl-L-homoserine lactones in a variety of other bacteria. The existence of two different and unrelated autoinducer synthesis genes suggests the occurrence of convergent evolution in the synthesis of homoserine lactone signaling molecules. The C-terminal half of
AinS
shows homology to a putative protein in Vibrio harveyi,
LuxM
, which is required for the synthesis of a V. harveyi bioluminescence autoinducer. Together,
AinS
and
LuxM
define a new family of autoinducer synthesis proteins. Furthermore, the predicted product of another gene, ainR, encoded immediately downstream of ainS, shows homology to LuxN, which is similarly encoded downstream of luxM in V. harveyi and proposed to have sensor/regulator functions in the bioluminescence response to the V. harveyi auto inducer. This similarity presents the possibility that AI-2, besides interacting with LuxR, also interacts with AinR under presently unknown conditions.
...
PMID:AinS and a new family of autoinducer synthesis proteins. 759 89
N-Acylhomoserine lactone (acyl-HSL)-mediated gene expression, also called autoinduction, is conserved among diverse gram-negative bacteria. In the paradigm Vibrio fischeri system, bioluminescence is autoinducible, and the lux operon requires the
transcriptional activator
LuxR and the acyl-HSL autoinducer for expression. The production of the acyl-HSL signal molecule is conferred by the luxI gene, and luxR encodes the transcriptional regulator. We show here that Erwinia stewartii, the etiological agent of Stewart's wilt of sweet corn, synthesizes an acyl-HSL. Mass spectral analysis identified the signal molecule as N-(-3-oxohexanoyl)-L-homoserine lactone, which is identical to the V. fischeri autoinducer. We have cloned and sequenced the gene that confers acyl-HSL biosynthesis, called esaI, and the linked gene, esaR, that encodes a gene regulator. The two genes are convergently transcribed and show an unusual overlap of 31 bp at their 3' ends. Sequence analysis indicates that
EsaI
and EsaR are homologs of
LuxI
and LuxR, respectively. EsaR can repress its own expression but seems not to regulate the expression of esaI. The untranslated 5' region of esaR contains an inverted repeat with similarity to the lux box-like elements located in the promoter regions of other gene systems regulated by autoinduction. However, unlike the other systems, in which the inverted repeats are located upstream of the -35 promoter elements, the esaR-associated repeat overlaps a putative -10 element. We mutagenized the esaI gene in E. stewartii by gene replacement. The mutant no longer produced detectable levels of the acyl-HSL signal, leading to a concomitant loss of extracellular polysaccharide capsule production and pathogenicity. Both phenotypes were restored by complementation with esal or by exogenous addition of the acyl-HSL.
...
PMID:Capsular polysaccharide biosynthesis and pathogenicity in Erwinia stewartii require induction by an N-acylhomoserine lactone autoinducer. 766 77
In Pseudomonas aeruginosa, the
transcriptional activator
LasR
and the Pseudomonas autoinducer PAI, are necessary for efficient transcriptional activation of the lasB gene, encoding elastase (L. Passador, J. M. Cook, M.J. Gambello, L. Rust, and B. H. Iglewski, Science 260:1127-1130, 1993). The transcriptional start points of lasI in Escherichia coli and P. aeruginosa were determined by S1 nuclease mapping. In the presence of both
LasR
and PAI, the start site, T1, is located at position -25 relative to the ATG translational start codon. A minor transcriptional start, T2, is found at position -13 when lasI is transcribed in the absence of either
LasR
or PAI in P. aeruginosa and E. coli, respectively. To begin to closely examine the regulation of lasI, whose product is involved in the synthesis of PAI, a lasI-lacZ fusion on a lambda phage was constructed to form monolysogens of E. coli MG4. Lysogens supplied only with either lasI or lasR via multicopy plasmids demonstrated no significant increase in beta-galactosidase expression compared with control levels. Lysogens in which both lasR and lasI were supplied in multicopy exhibited a 62-fold increase in expression, and a lysogen in which lasR was supplied in trans and which was grown in the presence of exogenous PAI exhibited a 60-fold increase. Thus,
LasR
and PAI are necessary for the full expression of lasI in E. coli. The interchangeability of the P. aeruginosa and Vibrio fischeri homologs
LasR
and LuxR and their respective autoinducers, PAI and VAI, as activators of lasI-lacZ was examined. Only the combination of
LasR
and PAI significantly increased the expression of lasI. The comparison of lasI-lacZ and lasB-lacZ expression lysogens grown in the presence of lasR and PAI revealed that half-maximal expression of lasI required 0.1 nM PAI, in contrast to the 1.0 nM PAI necessary for lasB half-maximal expression. These results suggest an autoinduction regulatory hierarchy in which
LasR
and low PAI concentrations primarily activate lasI expression in a regulatory loop. With the accumulation of PAI, secondary activation of virulence product genes such as lasB occurs.
...
PMID:Activation of the Pseudomonas aeruginosa lasI gene by LasR and the Pseudomonas autoinducer PAI: an autoinduction regulatory hierarchy. 783 99
In Vibrio fischeri, the synthesis of N-3-oxohexanoyl-L-homoserine lactone, the autoinducer for population density-responsive induction of the luminescence operon (the lux operon, luxICDABEG), is dependent on the
autoinducer synthase
gene luxI. Gene replacement mutants of V. fischeri defective in luxI, which had been expected to produce no autoinducer, nonetheless exhibited lux operon transcriptional activation. Mutants released into the medium a compound that, like N-3-oxohexanoyl-L-homoserine lactone, activated expression of the lux system in a dose-dependent manner and was both extractable with ethyl acetate and labile to base. The luxI-independent compound, also like N-3-oxohexanoyl-L-homoserine lactone, was produced by V. fischeri cells in a regulated, population density-responsive manner and required the
transcriptional activator
LuxR for activity in the lux system. The luxI-independent compound was identified as N-octanoyl-L-homoserine lactone by coelution with the synthetic compound in reversed-phase high-pressure liquid chromatography, by derivatization treatment with 2,4-dinitrophenylhydrazine, by mass spectrometry, and by nuclear magnetic resonance spectroscopy. A locus, ain, necessary and sufficient for Escherichia coli to synthesize N-octanoyl-L-homoserine lactone was cloned from the V. fischeri genome and found to be distinct from luxI by restriction mapping and Southern hybridization. N-Octanoyl-L-homoserine lactone and ain constitute a second, novel autoinduction system for population density-responsive signalling and regulation of lux gene expression, and possibly other genes, in V. fischeri. A third V. fischeri autoinducer, N-hexanoyl-L-homoserine lactone, dependent on luxI for its synthesis, was also identified. The presence of multiple chemically and genetically distinct but cross-acting autoinduction systems in V. fischeri indicates unexpected complexity for autoinduction as a regulatory mechanism in this bacterium.
...
PMID:Multiple N-acyl-L-homoserine lactone autoinducers of luminescence in the marine symbiotic bacterium Vibrio fischeri. 800 80
A mutant strain (65E12) of Pseudomonas aeruginosa that is unable to produce rhamnolipid biosurfactants and lacks rhamnosyltransferase activity was genetically complemented by using a P. aeruginosa PG201 wild-type gene library. A single complementing cosmid was isolated on the basis of surface tension measurements of subcultures of the transconjugants by using a sib selection strategy. The subcloning of the complementing cosmid clone yielded a 2-kb fragment capable of restoring rhamnolipid biosynthesis, rhamnosyltransferase activity, and utilization of hexadecane as a C source in mutant 65E12. The nucleotide sequence of the complementing 2-kb fragment was determined, and a single open reading frame (rhlR) of 723 bp specifying a putative 28-kDa protein (RhlR) was identified. Sequence homologies between the RhlR protein and some regulatory proteins such as
LasR
of P. aeruginosa, LuxR of Vibrio fischeri, RhiR of Rhizobium leguminosarum, and the putative activator 28-kDa UvrC of Escherichia coli suggest that the RhlR protein is a
transcriptional activator
. A putative target promoter which is regulated by the RhlR protein has been identified 2.5 kb upstream of the rhlR gene. Multiple plasmid-based rhlR gene copies had a stimulating effect on the growth of the P. aeruginosa wild-type strain in hexadecane-containing minimal medium, on rhamnolipid production, and on the production of pyocyanin chromophores. Disruption of the P. aeruginosa wild-type rhlR locus led to rhamnolipid-deficient mutant strains, thus confirming directly that this gene is necessary for rhamnolipid biosynthesis. Additionally, such PG201::'rhlR' mutant strains lacked elastase activity, indicating that the RhlR protein is a pleiotropic regulator.
...
PMID:Isolation and characterization of a regulatory gene affecting rhamnolipid biosurfactant synthesis in Pseudomonas aeruginosa. 814 72
Autoinduction is a conserved mechanism of cell density-dependent gene regulation that occurs in a variety of gram-negative bacteria. Autoinducible luminescence in Vibrio fischeri requires a
transcriptional activator
, LuxR, while a LuxR homolog,
LasR
, activates elastase expression in Pseudomonas aeruginosa. Both LuxR and
LasR
require specific signal molecules, called autoinducers, for activity. We show here the activation in Escherichia coli of the V. fischeri luminescence (lux) operon by
LasR
and of the P. aeruginosa elastase gene (lasB) by LuxR when each is in the presence of its cognate autoinducer. Neither LuxR nor
LasR
showed appreciable activity with the heterologous V. fischeri or P. aeruginosa autoinducer. This supports the view that there is a direct interaction of each
transcriptional activator
with its proper autoinducer and suggests that there are conserved, autoinduction-related elements within the promoter regions of these genes.
...
PMID:Interchangeability and specificity of components from the quorum-sensing regulatory systems of Vibrio fischeri and Pseudomonas aeruginosa. 818 10
1
2
3
4
Next >>