Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:2.3.1.184 (LasR)
897 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Expression of the Vibrio fischeri luminescence genes (luxR and luxICDABEG) in Escherichia coli requires autoinducer (N-3-oxohexanoyl homoserine lactone) and LuxR protein, which activate transcription of luxICDABEG (genes for autoinducer synthase and the luminescence enzymes), and cyclic AMP (cAMP) and cAMP receptor protein (CRP), which activate transcription of the divergently expressed luxR gene. In E. coli and in V. fischeri, the autoinducer-LuxR protein-dependent induction of luxICDABEG transcription (called autoinduction) is delayed by glucose, whereas it is promoted by iron restriction, but the mechanisms for these effects are not clear. To examine in V. fischeri control of lux gene expression by autoinducer, cAMP, glucose, and iron, lux::Mu dI(lacZ) and lux deletion mutants of V. fischeri were constructed by conjugation and gene replacement procedures. beta-Galactosidase synthesis in a luxC::lacZ mutant exhibited autoinduction. In a luxR::lacZ mutant, complementation by the luxR gene was necessary for luminescence, and addition of cAMP increased beta-galactosidase activity four- to sixfold. Furthermore, a luxI::lacZ mutant produced no detectable autoinducer but responded to its addition with induced synthesis of beta-galactosidase. These results confirm in V. fischeri key features of lux gene regulation derived from studies with E. coli. However, beta-galactosidase specific activity in the luxI::lacZ mutant, without added autoinducer, exhibited an eight- to tenfold decrease and rise back during growth, as did beta-galactosidase and luciferase specific activities in the luxR::lacZ mutant and luciferase specific activity in a delta(luxR luxICD) mutant. The presence of glucose delayed the rise back in beta-galactosidase and luciferase specific activities in these strains, whereas iron restriction promoted it. Thus, in addition to transcriptional control by autoinducer and LuxR protein, the V. fischeri lux system exhibits a cell density-dependent modulation of expression that does not require autoinducer, LuxR protein, or known lux regulatory sites. The response of autoinducer-LuxR protein-independent modulation to glucose and iron may account for how these environmental factors control lux gene expressions.
...
PMID:Cell density-dependent modulation of the Vibrio fischeri luminescence system in the absence of autoinducer and LuxR protein. 131 12

Regulation of expression of bioluminescence from the Vibrio fischeri lux regulon in Escherichia coli is a consequence of a unique form of positive feedback superimposed on a poorly defined cis-acting repression mechanism. The lux regulon consists of two divergently transcribed operons. The leftward operon contains only a single gene, luxR, which encodes a transcriptional activator protein. The rightward operon contains luxI, which together with luxR and the 218 base pairs separating the two operons comprises the primary regulatory circuit, and the five structural genes, luxC, luxD, luxA, luxB and luxE, which are required for the bioluminescence activity. Transcription of luxR from PL is stimulated by binding of the E. coli crp gene product to the sequence TGTGACAAAAATCCAA upstream of the presumed promoter. Binding of pure E. coli CAP protein in a cAMP-dependent reaction to the V. fischeri lux regulatory region has been demonstrated by in vitro footprinting. The luxI gene product is an enzyme which catalyses a condensation reaction of cytoplasmic substrates to yield the autoinducer, N-(3-oxo-hexanoyl) homoserine lactone. Accumulation of autoinducer, which is freely diffusible, results in formation of a complex with LuxR. The complex binds to the sequence ACCTGTAGGATCGTACAGGT upstream of PR to stimulate transcription of the rightward operon. Increased transcription from PR should yield increased levels of LuxI and higher levels of autoinducer which would further activate LuxR. The LuxR binding site is also a LexA binding site, as demonstrated by in vitro footprinting. Basal transcription from both PL and PR is repressed by sequences within the luxR coding region.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Control of the lux regulon of Vibrio fischeri. 218 99

In recent years it has become clear that the production of N-acyl homoserine lactones (N-AHLs) is widespread in Gram-negative bacteria. These molecules act as diffusible chemical communication signals (bacterial pheromones) which regulate diverse physiological processes including bioluminescence, antibiotic production, plasmid conjugal transfer and synthesis of exoenzyme virulence factors in plant and animal pathogens. The paradigm for N-AHL production is in the bioluminescence (lux) phenotype of Photobacterium fischeri (formerly classified as Vibrio fischeri) where the signalling molecule N-(3-oxohexanoyl)-L-homoserine lactone (OHHL) is synthesized by the action of the LuxI protein. OHHL is thought to bind to the LuxR protein, allowing it to act as a positive transcriptional activator in an autoinduction process that physiologically couples cell density (and growth phase) to the expression of the bioluminescence genes. Based on the growing information on LuxI and LuxR homologues in other N-AHL-producing bacterial species such as Erwinia carotovora, Pseudomonas aeruginosa, Yersinia enterocolitica, Agrobacterium tumefaciens and Rhizobium leguminosarum, it seems that analogues of the P. fischeri lux autoinducer sensing system are widely distributed in bacteria. The general physiological function of these simple chemical signalling systems appears to be the modulation of discrete and diverse metabolic processes in concert with cell density. In an evolutionary sense, the elaboration and action of these bacterial pheromones can be viewed as an example of multicellularity in prokaryotic populations.
...
PMID:The bacterial 'enigma': cracking the code of cell-cell communication. 747 57

In Pseudomonas aeruginosa PAO1, expression of elastase is dependent upon an interaction between the positive transcriptional activator LasR and the auto-inducer molecule N-(3-oxododecanoyl)-L-homoserine lactone (OdDHL), the synthesis of which is directed by LasI. Previously we have shown that in PAN067, an elastase-negative mutant of PAO1, elastase production can be restored to some extent by addition of exogenous N-(3-oxohexanoyl)-L-homoserine lactone (OHHL). Here we report that PAN067 is also defective in the production of alkaline protease, haemolysin, cyanide, pyocyanin and autoinducer(s). As neither addition of exogenous OdDHL nor introduction of lasR restored PAN067 to the parental phenotype, we sought to complement PAN067 with PAO1 DNA. From a cosmid library, a 2 kb DNA fragment was identified which re-established production of autoinducer(s) and exoproducts in PAN067. From the nucleotide sequence of this fragment, two genes termed rhIR and rhII were identified. RhII is responsible for autoinducer synthesis and shares 31% homology with LasI; RhIR has been previously identified in P. aeruginosa strain DSM2659 as a regulator of rhamnolipid biosynthesis and shares 28% identity with LasR. These data provide clear evidence that multiple families of quorum-sensing modulons interactively regulate gene expression in P. aeruginosa.
...
PMID:Multiple homologues of LuxR and LuxI control expression of virulence determinants and secondary metabolites through quorum sensing in Pseudomonas aeruginosa PAO1. 749 82

Yersinia enterocolitica produces compounds capable of transcriptionally activating the Photobacterium fischeri bioluminescence (lux) operon. Using high-performance liquid chromatography, high resolution tandem mass spectrometry in conjunction with chemical synthesis, two signal molecules were identified and shown to be N-hexanoyl-L-homoserine lactone (HHL) and N-(3-oxohexanoyl)-L-homoserine lactone (OHHL). A gene (yenI) was isolated from Y. enterocolitica and demonstrated to direct the synthesis of both HHL and OHHL. DNA sequence analysis revealed an open reading frame (ORF) of 642 bp encoding a protein (YenI) of 24.6 kDa with approximately 20% identity to the LuxI family of proteins. Northern blot analysis of yenI expression indicated yenI is transcribed as a single gene and 5' transcript mapping of yenI identified a transcriptional start site 89 bp upstream of the ORF. DNA sequence analysis of the region downstream of yenI located a second ORF, termed yenR, with significant homology to the LuxR family of transcriptional activators. An insertion mutation of yenI abolishes HHL and OHHL production, indicating its central role in N-acylhomoserine lactone synthesis in Y. enterocolitica. Transcriptional analysis using a chromosomal yenI::luxAB fusion has demonstrated that yenI is not subject to autoinduction but is expressed constitutively. Whilst production of the Yop proteins in the wild type and in yenI mutants is indistinguishable, two-dimensional SDS-PAGE analysis of total cell proteins indicated that a number of proteins lack the yenI mutant.
...
PMID:Characterisation of the yenI/yenR locus from Yersinia enterocolitica mediating the synthesis of two N-acylhomoserine lactone signal molecules. 749 83

Pseudomonas aeruginosa produces a spectrum of exoproducts many of which have been implicated in the pathogenesis of human infection. Expression of some of these factors requires cell-cell communication involving the interaction of a small diffusible molecule, an "autoinducer," with a positive transcriptional activator. In P. aeruginosa PAO1, LasI directs the synthesis of the autoinducer N-(3-oxododecanoyl)-L-homoserine lactone (OdDHL), which activates the positive transcriptional activator, LasR. Recently, we have discovered a second signaling molecule-based modulon in PAO1, termed vsm, which contains the genes vsmR and vsmI. Using HPLC, mass spectrometry, and NMR spectroscopy we now establish that in Escherichia coli, VsmI directs the synthesis of N-butanoyl-L-homoserine lactone (BHL) and N-hexanoyl-L-homoserine lactone (HHL). These compounds are present in the spent culture supernatants of P. aeruginosa in a molar ratio of approximately 15:1 and their structures were unequivocally confirmed by chemical synthesis. Addition of either BHL or HHL to PAN067, a pleiotropic P. aeruginosa mutant unable to synthesize either of these autoinducers, restored elastase, chitinase, and cyanide production. In E. coli carrying a vsmR/vsmI'::lux transcriptional fusion, BHL and HHL activated VsmR to a similar extent. Analogues of these N-acyl-L-homoserine lactones in which the N-acyl side chain has been extended and/or oxidized at the C-3 position exhibit substantially lower activity (e.g., OdDHL) or no activity (e.g., dDHL) in this lux reporter assay. These data indicate that multiple families of quorum sensing modulons interactively regulate gene expression in P. aeruginosa.
...
PMID:Multiple N-acyl-L-homoserine lactone signal molecules regulate production of virulence determinants and secondary metabolites in Pseudomonas aeruginosa. 756 46

In Vibrio fischeri, the autoinducer N-3-oxohexanoyl-L-homoserine lactone (AI-1) governs the cell density-dependent induction of the luminescence operon via the LuxR transcriptional activator. The synthesis of AI-1 from bacterial metabolic intermediates is dependent on luxI. Recently, we found a second V. fischeri autoinducer molecule, N-octanoyl-L-homoserine lactone (AI-2), that in E. coli also activates the luminescence operon via LuxR. A locus independent of luxI was identified as being required for AI-2 synthesis. This 2.7-kb ain (autoinducer) locus was characterized by transposon insertion mutagenesis, deletion and complementation analysis, and DNA sequencing. A single 1,185-bp gene, ainS, was found to be the sole exogenous gene necessary for the synthesis of AI-2 in Escherichia coli. In addition, a V. fischeri ainS mutant produced AI-1 but not AI-2, confirming that in its native species ainS is specific for the synthesis of AI-2. ainS is predicted to encode a 45,580-Da protein which exhibits no similarity to LuxI or to any of the LuxI homologs responsible for the synthesis of N-acyl-L-homoserine lactones in a variety of other bacteria. The existence of two different and unrelated autoinducer synthesis genes suggests the occurrence of convergent evolution in the synthesis of homoserine lactone signaling molecules. The C-terminal half of AinS shows homology to a putative protein in Vibrio harveyi, LuxM, which is required for the synthesis of a V. harveyi bioluminescence autoinducer. Together, AinS and LuxM define a new family of autoinducer synthesis proteins. Furthermore, the predicted product of another gene, ainR, encoded immediately downstream of ainS, shows homology to LuxN, which is similarly encoded downstream of luxM in V. harveyi and proposed to have sensor/regulator functions in the bioluminescence response to the V. harveyi auto inducer. This similarity presents the possibility that AI-2, besides interacting with LuxR, also interacts with AinR under presently unknown conditions.
...
PMID:AinS and a new family of autoinducer synthesis proteins. 759 89

The opportunistic human pathogen Pseudomonas aeruginosa produces a variety of virulence factors, including exotoxin A, elastase, alkaline protease, alginate, phospholipases, and extracellular rhamnolipids. The previously characterized rhlABR gene cluster encodes a regulatory protein (RhlR) and a rhamnosyltransferase (RhlAB), both of which are required for rhamnolipid synthesis. Another gene, rhII, has now been identified downstream of the rhlABR gene cluster. The putative RhlI protein shares significant sequence similarity with bacterial autoinducer synthetases of the LuxI type. A P. aeruginosa rhlI mutant strain carrying a disrupted rhlI gene was unable to produce rhamnolipids and lacked rhamnosyltransferase activity. Rhamnolipid synthesis was restored by introducing a wild-type rhlI gene into such strains or, alternatively, by adding either the cell-free spent supernatant from a P. aeruginosa wild-type strain or synthetic N-acylhomoserine lactones. Half-maximal induction of rhamnolipid synthesis in the rhlI mutant strain required 0.5 microM N-butyrylhomoserine lactone or 10 microM N-(3-oxohexanoyl)homoserine lactone. The P. aeruginosa rhlA promoter was active in the heterologous host Pseudomonas putida when both the rhlR and rhlI genes were present or when the rhlR gene alone was supplied together with synthetic N-acylhomoserine lactones. The RhlR-RhlI regulatory system was found to be essential for the production of elastase as well, and cross-communication between the RhlR-RhlI rhamnolipid regulatory system and the LasR-LasI elastase regulatory system was demonstrated.
...
PMID:Autoinducer-mediated regulation of rhamnolipid biosurfactant synthesis in Pseudomonas aeruginosa. 760 6

N-Acylhomoserine lactone (acyl-HSL)-mediated gene expression, also called autoinduction, is conserved among diverse gram-negative bacteria. In the paradigm Vibrio fischeri system, bioluminescence is autoinducible, and the lux operon requires the transcriptional activator LuxR and the acyl-HSL autoinducer for expression. The production of the acyl-HSL signal molecule is conferred by the luxI gene, and luxR encodes the transcriptional regulator. We show here that Erwinia stewartii, the etiological agent of Stewart's wilt of sweet corn, synthesizes an acyl-HSL. Mass spectral analysis identified the signal molecule as N-(-3-oxohexanoyl)-L-homoserine lactone, which is identical to the V. fischeri autoinducer. We have cloned and sequenced the gene that confers acyl-HSL biosynthesis, called esaI, and the linked gene, esaR, that encodes a gene regulator. The two genes are convergently transcribed and show an unusual overlap of 31 bp at their 3' ends. Sequence analysis indicates that EsaI and EsaR are homologs of LuxI and LuxR, respectively. EsaR can repress its own expression but seems not to regulate the expression of esaI. The untranslated 5' region of esaR contains an inverted repeat with similarity to the lux box-like elements located in the promoter regions of other gene systems regulated by autoinduction. However, unlike the other systems, in which the inverted repeats are located upstream of the -35 promoter elements, the esaR-associated repeat overlaps a putative -10 element. We mutagenized the esaI gene in E. stewartii by gene replacement. The mutant no longer produced detectable levels of the acyl-HSL signal, leading to a concomitant loss of extracellular polysaccharide capsule production and pathogenicity. Both phenotypes were restored by complementation with esal or by exogenous addition of the acyl-HSL.
...
PMID:Capsular polysaccharide biosynthesis and pathogenicity in Erwinia stewartii require induction by an N-acylhomoserine lactone autoinducer. 766 77

The pheromone N-(3-oxohexanoyl)-L-homoserine lactone (OHHL) regulates expression of bioluminescence in the marine bacterium Vibrio fischeri, the production of carbapenem antibiotic in Erwinia carotovora and exoenzymes in both E. carotovora and Pseudomonas aeruginosa. A characteristic feature of this regulatory mechanism in V. fischeri is that it is cell density-dependent, reflecting the need to accumulate sufficient pheromone to trigger the induction of gene expression. Using a lux plasmid-based bioluminescent sensor for OHHL, pheromone production by E. carotovora, Enterobacter agglomerans, Hafnia alvei, Rahnella aquatilis and Serratia marcescens has been demonstrated and shown also to be cell density-dependent. Production of OHHL implies the presence in these bacteria of a gene equivalent to luxI. Chromosomal banks from all five enteric bacteria have yielded clones capable of eliciting OHHL production when expressed in Escherichia coli. The luxI homologue from both E. carotovora (carI) and E. agglomerans (eagI) were characterized at the DNA sequence level and the deduced protein sequences have only 25% identity with the V. fischeri LuxI. Despite this, carI, eagI and luxI are shown to be biologically equivalent. An insertion mutant of eagI demonstrates that this gene is essential for OHHL production in E. agglomerans.
...
PMID:A novel strategy for the isolation of luxI homologues: evidence for the widespread distribution of a LuxR:LuxI superfamily in enteric bacteria. 796 29


1 2 3 4 5 6 7 8 9 10 Next >>

---