Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:2.3.1.184 (
LasR
)
897
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Regulation of expression of bioluminescence from the Vibrio fischeri lux regulon in Escherichia coli is a consequence of a unique form of positive feedback superimposed on a poorly defined cis-acting repression mechanism. The lux regulon consists of two divergently transcribed operons. The leftward operon contains only a single gene, luxR, which encodes a transcriptional activator protein. The rightward operon contains luxI, which together with luxR and the 218 base pairs separating the two operons comprises the primary regulatory circuit, and the five structural genes, luxC, luxD, luxA, luxB and luxE, which are required for the bioluminescence activity. Transcription of luxR from PL is stimulated by binding of the E. coli crp gene product to the sequence TGTGACAAAAATCCAA upstream of the presumed promoter. Binding of pure E. coli CAP protein in a
cAMP
-dependent reaction to the V. fischeri lux regulatory region has been demonstrated by in vitro footprinting. The luxI gene product is an enzyme which catalyses a condensation reaction of cytoplasmic substrates to yield the autoinducer, N-(3-oxo-hexanoyl) homoserine lactone. Accumulation of autoinducer, which is freely diffusible, results in formation of a complex with LuxR. The complex binds to the sequence ACCTGTAGGATCGTACAGGT upstream of PR to stimulate transcription of the rightward operon. Increased transcription from PR should yield increased levels of
LuxI
and higher levels of autoinducer which would further activate LuxR. The LuxR binding site is also a LexA binding site, as demonstrated by in vitro footprinting. Basal transcription from both PL and PR is repressed by sequences within the luxR coding region.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Control of the lux regulon of Vibrio fischeri. 218 99
Full virulence of Yersinia enterocolitica Biovar 1B requires two distinct and distantly related contact-dependent type III secretion (T3S) systems. The plasmid-encoded Ysc T3S system is essential for systemic stages of infection and the Yop effector proteins it translocates have been extensively studied. The chromosome-encoded Ysa T3S system contributes to gastrointestinal stages of infection, but the suite of Ysp effectors proteins it translocates into host cells remains obscure. Using a proteomics-based approach, the Ysa T3S system was analysed revealing a complex set of 15 secreted Ysp proteins. Seven of these proteins were previously described (YspA, YspB, YspC, YspD, YopE, YopN and YopP). Eight of these Ysps (YspK,
YspI
, YspE, YspF, YspP, YspY, YspN and YspL) had not previously been characterized. Several of the new Ysps are homologous to other virulence factors, including YspP with similarity to the Yersinia protein tyrosine phosphatase YopH and YspK with similarity to the Shigella serine/threonine kinase OspG. Biochemical analysis of purified hexa-histidine tagged YspK and YspP established that these proteins have kinase and phosphatase activity respectively. Infection of eukaryotic cells with Y. enterocolitica strains expressing a Ysp-CyaA chimeric protein resulted in Ysa T3S system-dependent increases in cytosolic levels of
cAMP
for six Ysps (YspK,
YspI
, YspE, YspF, YspP and YspL), but not two others (YspY and YspN). YspN, however, was required for translocation of effector proteins into eukaryotic cells by the Ysa T3S system. Competition assays in BALB/c mice revealed that mutants defective for the production of an individual Ysp are affected for colonization of gastrointestinal tissues. Collectively, the results of this study support the hypothesis that the Ysa T3S system targets a complex suite of effector proteins into host cells to affect the outcome of an infection. Identification of the suite of effectors delivered by the Ysa T3S system reveals that host cell signalling pathways are the probable targets of several Ysp effectors.
...
PMID:Proteomic and functional analysis of the suite of Ysp proteins exported by the Ysa type III secretion system of Yersinia enterocolitica Biovar 1B. 1639 Apr 60