Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:1.5.1.3 (dihydrofolate reductase)
 5,819 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The nucleotide sequence of 6.2 kb (1 kb = 10(3) base-pairs) of DNA that encompasses the earliest replicating portion of the amplified dihydrofolate reductase domains of CHOC 400 cells has been determined. Origin region DNA contains two AluI family repeats, a novel repetitive element (termed ORR-1), a TGGGT-rich region, and several homopurine/homopyrimidine and alternating purine/pyrimidine tracts, including an unusual cluster of simple repeating sequences composed of (G-C)5, (A-C)18, (A-G)21, (G)9, (CAGA)4, GAGGGAGAGAGGCAGAGAGGG, (A-G)27. Recombinant plasmids containing origin region sequences were examined for DNA structural conformations previously implicated in origin activation. Mung bean nuclease sensitivity assays for DNA unwinding elements show the preferred order of nuclease cleavage at neutral pH in supercoiled origin plasmids to be: (A-T)23 much greater than the (A-G) cluster much greater than (A)38 much greater than vector = (AATT)n. At acid pH, the hierarchy of cleavage preferences changes to: the (A-G) cluster much greater than (A-T)23 much greater than (AATT)n greater than vector = (A)38. A region of stably bent DNA was identified and shown not to be reactive in the mung bean nuclease unwinding assay at either acid or neutral pH. Intermolecular hybridization studies show that, in the presence of torsional stress at pH 5.2, the (A-G) cluster forms triple-stranded DNA. These results show that the origin region of an amplified chromosomal replicon contains a novel repetitive element and multiple sequence elements that facilitate DNA bending, DNA unwinding and the formation of intramolecular triple-stranded DNA.
 ...
PMID:Intramolecular DNA triplexes, bent DNA and DNA unwinding elements in the initiation region of an amplified dihydrofolate reductase replicon. 229 70

Two SV40-transformed human cell lines, GM637, derived from a normal human subject, and GM5849, derived from a patient with ataxia-telangiectasia (A-T), were grown in increasing concentrations of the cytotoxic agent methotrexate (MTX). The GM637 line was naturally more resistant to methotrexate than was GM5849 and, over a 5-month period, became resistant even to very high concentrations (up to 100 microM). The GM5849 line became resistant to 500 nM methotrexate during the same period. However, dot blot and Southern blot analyses showed that both cell lines had amplified their dihydrofolate reductase (dhfr) genes to about the same extent, approx. 50-fold. Using the GM5849 line with amplified dhfr, we attempted to determine if interruption of DNA synthesis by hydroxyurea would cause DNA to be replicated twice within a single cell cycle, as has been reported for Chinese hamster ovary cells. No evidence for such a phenomenon was obtained.
 ...
PMID:Establishment and characterization of two human cell lines with amplified dihydrofolate reductase genes. 302 20

The continuous sequence of 2.3 kilobases in a 3-kilobase DNA fragment encoding the structural gene for coliphage T4 thymidylate synthase (5,10-methylenetetrahydrofolate:dUMP C-methyltransferase, EC 2.1.1.45) was determined by using the M13 dideoxy chain-termination method. From the coding information within this gene and that provided by sequence analysis of selected CNBr peptides from the protein product, the primary structure of T4 thymidylate synthase was determined. The most significant finding of these studies is the presence of a 1017-base-pair interruption two-thirds of the way through the nucleotide sequence of the structural gene. The 5'- and 3'-terminal ends of this intron are demarcated by an apparent stop and start codon, respectively. The corresponding methionine preceding the second coding region of the synthase is not incorporated into the final protein product. Structural evidence confirming the presence of the intervening sequence in the phage genome was obtained by restriction and hybridization analysis. Support for the presence of the intron was also obtained at the functional level by enzyme expression studies using selected td gene fragments. This work also confirms the findings of Purohit and Mathews [ Purohit , S. & Mathews , C. K. (1983) Fed. Proc. Fed. Am. Soc. Exp. Biol. 42, 1759], which reveal that the termination codon for the dihydrofolate reductase gene and the triplet initiating thymidylate synthase overlap by a four-base stretch, A-T-G-A. The implications of this unusual gene arrangement are discussed.
 ...
PMID:Intervening sequence in the thymidylate synthase gene of bacteriophage T4. 632 92