Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:1.5.1.3 (dihydrofolate reductase)
5,819 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element.
...
PMID:Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element. 371 72

The processed pseudogenes reported to date fall into three categories: those that are a complete copy of the mRNA transcribed from the functional gene, those that are only a partial copy of the corresponding mRNA, and those that contain sequences in addition to those expected to be present in the mRNA. The general structural characteristics of these processed pseudogenes include the complete lack of intervening sequences found in the functional counterparts, a poly A tract at the 3' end, and direct repeats flanking the pseudogene sequence. In all the cases studied, these pseudogenes have been found to be on a different chromosome from their functional counterpart. These characteristics have led investigators to suggest that an RNA intermediate, in many cases the mRNA of the functional gene, is involved in the production of these pseudogenes. The mechanism by which processed pseudogenes arose involves the integration of the mRNA, or its cDNA copy, into a staggered chromosome break, followed by DNA synthesis and repair. I suggest that all the transcripts that gave rise to these pseudogenes were actually produced in the germ line cell. The transcripts that gave rise to the processed pseudogenes that are direct copies of the corresponding mRNA resulted from RNA polymerase II transcription of the functional counterpart. Pseudogenes that are not a direct copy of the corresponding mRNA may have resulted from RNA polymerase III transcription. If this is indeed the case, one need not postulate the involvement of retroviruses to explain the presence of processed pseudogenes corresponding to genes that are not expressed in the germ line. Following the integration event, processed pseudogenes can no longer be transcribed to produce the functional mRNA from which they arose. This inability to be transcribed by RNA polymerase II is not surprising considering that processed pseudogenes seem to be randomly integrated into the genome. Therefore, integration of a processed pseudogene such that RNA polymerase II transcriptional promoters are correctly positioned 5' to the resultant pseudogene is an unlikely event. The presence of processed pseudogenes seems peculiar to mammals. In fact, evolutionary studies indicate that processed pseudogenes are of relatively recent origin. In fact, at least one processed pseudogene, the human DHFR psi 1, has been formed so recently that it is polymorphic.
...
PMID:Processed pseudogenes: characteristics and evolution. 390 43

The growth of MCF-7 cells was arrested by 24 h of isoleucine deprivation. Following replenishment of the medium, the incorporation of uridine and thymidine into trichloroacetic acid-precipitable material began to increase slowly and gradually rose to the level of cycling cells. The addition of 5 X 10(-9) M estradiol to growth-arrested cells dramatically shortened the time of onset of macromolecular synthesis and increased the overall amount of precursor incorporation 2- to 4-fold over the level obtained by arrested control cells. The increase in uridine incorporation preceded the increase in thymidine incorporation by 6 h. Inhibition of protein synthesis with cycloheximide blocked the recovery of macromolecular synthesis in both control and estrogen-treated cells. Actinomycin D was ineffective in blocking the estrogen-stimulated recovery of macromolecular synthesis at concentrations known to inhibit pre-rRNA synthesis (10(-8) M). At higher concentrations, uridine and thymidine incorporation were inhibited in a dose-dependent manner. Inhibition of RNA polymerase II activity with alpha-amanitin similarly blocked both the recovery of the cells from isoleucine starvation and the potentiation of this by estradiol. Dihydrofolate reductase and thymidine kinase activities are both stimulated by estradiol in MCF-7 cells. In cycling cells, estrogen stimulates a 2-fold increase in their messenger RNAs (mRNAs) within 24 h. The level of dihydrofolate reductase mRNA is unaffected by isoleucine starvation, and estrogen caused no change in dihydrofolate reductase mRNA levels over a 24-h period following reversal of growth arrest. Similar results were observed for the 600-nucleotide pS2 mRNA that has been identified as an estrogen-induced RNA in MCF-7 cells. In contrast, thymidine kinase mRNA was found to be increased by estrogen at 24 h, but not at 12 h, following reversal of growth arrest. This increase correlates with increases in thymidine, but not uridine incorporation. These data indicate that the estrogen-stimulated increase in thymidine incorporation following release from growth arrest is dependent on new RNA synthesis. However, the hormone did not increase the levels of three estrogen-regulated mRNAs coordinately with the increases observed in uridine incorporation.
...
PMID:Relationship between the expression of estrogen-regulated genes and estrogen-stimulated proliferation of MCF-7 mammary tumor cells. 398 99

We have studied the rate of transcription of the gene for dihydrofolate reductase (DHFR) in mouse 3T6 fibroblasts during serum-induced transitions between the resting (G0) and growing states. As a model system, we have used a methotrexate-resistant 3T6 cell line that overproduces DHFR and its mRNA about 300-fold, yet regulates the expression of the DHFR gene in the same manner as normal 3T6 cells. In previous studies, we showed that the rate of production of cytoplasmic DHFR mRNA relative to total mRNA is about 4 times lower in resting than in exponentially growing cells. The rate increases to the growing value by about 15 hr following serum stimulation of the resting cells. This increase appeared to be controlled by regulating the rate of synthesis of DHFR hnRNA. In this study, we analyze the transcription of the DHFR gene in more detail. We use a variety of labeling times and RNA extraction procedures to measure the rate of synthesis of DHFR hnRNA relative to total hnRNA in pulse-labeled cells or in nuclei isolated from cells at various times following serum stimulation. The amount of labeled DHFR RNA is determined by DNA-excess filter hybridization. In all cases, the relative rate of synthesis of DHFR hnRNA increases at the same time, and to the same extent, as the rate of production of DHFR mRNA, suggesting that the increase in DHFR mRNA production is due to a corresponding increase in the rate of transcription of the DHFR gene. The increase in DHFR gene transcription is not blocked by cytosine arabinoside, showing that the increase does not depend on gene duplication. In isolated nuclei, DHFR RNA synthesis is inhibited by alpha-amanitin (1 microgram/ml), indicating that the DHFR gene is transcribed by RNA polymerase II. Others have shown that when stationary phase cells are stimulated to proliferate, the increase in DHFR mRNA content is controlled primarily at the post-transcriptional level. Therefore, it appears that the rate of production of DHFR mRNA is controlled by different biochemical mechanisms when cells are in different physiological states.
...
PMID:In vitro and in vivo analysis of the control of dihydrofolate reductase gene transcription in serum-stimulated mouse fibroblasts. 669 Apr 54

Recently, it has been demonstrated that nitrogen mustard-induced N-alkylpurines are excised rapidly from actively transcribing genes, while they persist longer in noncoding regions and in the genome overall. It was suggested that transcriptional activity is implicated as a regulatory element in the efficient removal of lesions. By treating cells or not with the transcription inhibitor alpha-amanitin, we have explored whether ongoing activity of RNA polymerase II was coordinately related to proficient repair of nitrogen mustard-induced alkylation products in the actively transcribed dihydrofolate reductase gene in the Chinese hamster ovary B11 cells. Nuclear run-off transcription analysis verified that alpha-amanitin completely and selectively inhibited transcription by RNA polymerase II. At the drug exposure examined, nitrogen mustard induced DNA damage capable of a complete transcription termination in the RNA polymerase II-transcribed dihydrofolate reductase gene and reduced 28S rDNA transcription by a factor of 7.9. The transcription activity did partially recover following reincubation in drug-free medium; this recovery was about 34 and 76% of ribosomal 28S gene transcripts and dihydrofolate reductase gene transcripts, respectively, after 6 h of repair incubation. alpha-Amanitin significantly inhibited the removal of nitrogen mustard-induced N-alkylpurines in the 5'-half of the essential, constitutively active dihydrofolate reductase gene, while no effect of alpha-amanitin was observed on the lesion removal from a noncoding region 3'-flanking to the gene and from the genome overall. In the actively transcribed gene region, about 77% of N-alkylpurines were removed 21 h following drug exposure of cells not treated with alpha-amanitin and about 47% in 21 h in alpha-amanitin treated cells. The global semiconservative replication seemed unaffected by the alpha-amanitin treatment. From these results we suggest that gene-specific repair of nitrogen mustard-induced N-alkylpurines is dependent on ongoing activity of the transcribing RNA polymerase II. The findings are discussed in terms of the current ideas about the mechanism of preferential DNA repair.
...
PMID:Ongoing activity of RNA polymerase II confers preferential repair of nitrogen mustard-induced N-alkylpurines in the hamster dihydrofolate reductase gene. 750 96

Previous studies have demonstrated transcription-coupled DNA repair in mammalian genes transcribed by RNA polymerase II but not in ribosomal RNA genes (rDNA), which are transcribed by RNA polymerase I. The removal of UV-induced cyclobutane pyrimidine dimers (CPD) from rDNA in repair-proficient human cells has been shown to be slow but detectable and apparently not coupled to transcription. We studied the induction and removal of CPD from rDNA in cultured cells from two repair-deficient human disorders. Primary xeroderma pigmentosum complementation group C (XP-C) cells, whether proliferating or nondividing, removed no CPD from either rDNA strand in 24 h post-UV, a result which supports earlier conclusions that XP-C cells lack the general, transcription-independent pathway of nucleotide excision repair. We also observed lower than normal repair of rDNA in Cockayne's syndrome (CS) cells from complementation groups A and B. In agreement with previous findings, the repair of both strands of the RNA polymerase II-transcribed dihydrofolate reductase gene was also deficient relative to that of normal cells. This strongly suggests that the defect in CS cells is not limited to a deficiency in a transcription-repair coupling factor. Rather, the defect may interfere with the ability of repair proteins to gain access to all expressed genes.
...
PMID:Repair in ribosomal RNA genes is deficient in xeroderma pigmentosum group C and in Cockayne's syndrome cells. 751 88

The C-terminal domain (CTD) of RNA polymerase II (RNAP II) is essential for the assembly of RNAP II into preinitiation complexes on some promoters such as the dihydrofolate reductase (DHFR) promoter. In addition, during the transition from a preinitiation complex to a stable elongation complex, the CTD becomes heavily phosphorylated. In this report, interactions involving the CTD have been examined by protein-protein cross-linking. As a prelude to the study of CTD interactions, the effect of recombinant CTD on in vitro transcription was examined. The presence of recombinant CTD inhibits in vitro transcription from both the DHFR and adenovirus 2 major late promoters, suggesting that the CTD is involved in essential interactions with a general transcription factor(s). Factors in the transcription extract that interact with the CTD were identified by protein-protein cross-linking. Recombinant CTD was phosphorylated at its casein kinase II site, at the C terminus of the CTD, in the presence of [35S]adenosine 5'-O-(thiotriphosphate) and alkylated with azidophenacyl bromide. Incubation of azido-modified 35S-labeled CTD with a HeLa transcription extract followed by ultraviolet irradiation results in the covalent cross-linking of the CTD to proteins in contact with the CTD at the time of irradiation. Subsequent incubation with phenylmercuric acetate results in the transfer of 35S from the CTD to the protein to which it was cross-linked. The two major photolabeled bands have a M(r) of 34,000 and 74,000. The specificity of CTD interactions was demonstrated by a reduction in photolabeling in the presence of unmodified CTD or RNAP II containing an intact CTD (RNAP IIA) but not in the presence of a CTD-less RNAP II (RNAP IIB). The 35S-labeled 34- and 74-kDa proteins comigrate on SDS-polyacrylamide gel electrophoresis with the beta subunit of transcription factor IIE and the 74-kDa subunit of transcription factor IIF, respectively. Moreover, some of the minor 35S-labeled bands comigrate with other subunits of the general transcription factors.
...
PMID:The photoactivated cross-linking of recombinant C-terminal domain to proteins in a HeLa cell transcription extract that comigrate with transcription factors IIE and IIF. 755 97

An array of tandem heptapeptide repeats at the carboxy-terminal domain (CTD) of the largest subunit of RNA polymerase II constitute a highly conserved structure essential for viability. Studies have established that the CTD is phosphorylated at different stages of the transcription cycle, and that it may be involved in transcriptional regulation. The exact role of the CTD remains elusive, as in vitro reconstituted transcription using the adenovirus major late promoter does not require the CTD. Previous studies showed that transcription from the murine dihydrofolate reductase (DHFR) promoter can be only accomplished by the form of RNA polymerase II that contains the hypophosphorylated CTD (RNAPIIA), but not by the form that lacks it (RNAPIIB). Here we show that the CTD, but not its phosphorylation, is required for initiation of transcription. We also show that transcription requires CTD kinase activity provided by the CDK subunit of TFIIH.
...
PMID:Requirement for TFIIH kinase activity in transcription by RNA polymerase II. 756 58

We have used an in vitro RNA polymerase II (RNAP II) inhibition-restimulation assay to investigate the inability of a form of RNAP II (RNAP IIB) that lacks the conserved, C-terminal heptapeptide repeat domain (CTD) to transcribe the dihydrofolate reductase (dhfr) promoter. Our previous studies demonstrated promoter-specific responses to RNAP IIB in the inhibition-restimulation assay and suggested the existence of cis-acting elements that alleviate the requirement for the CTD. We have now identified elements from two different classes of promoters that can convert dhfr to a CTD-independent promoter. First, addition of a consensus TATA box to the dhfr promoter resulted in a promoter capable of CTD-independent transcription and increased the promoter's affinity for the general transcription factor TFIID. These results suggest that high affinity for TFIID correlates with an ability to be transcribed by RNAP IIB, supporting a proposed interaction between the CTD and TFIID. Second, transfer of a combination of two elements (located at -25 and +1) from the rep-3b promoter, which does not contain a consensus TATA box but can nonetheless be transcribed by RNAP IIB, into the dhfr promoter also allowed CTD-independent transcription. These elements do not constitute a high affinity binding site for TFIID, indicating that an additional mechanism exists to allow CTD-independent transcription. Thus, elements from two classes of CTD-independent promoters that can obviate a requirement for the CTD appear to function via distinct mechanisms. Our finding that a change in a basal element can affect a requirement for the CTD is consistent with a role for the CTD during the formation of the transcriptional preinitiation complex.
...
PMID:Identification of cis-acting elements that can obviate a requirement for the C-terminal domain of RNA polymerase II. 789 26

The largest subunit of RNA polymerase II (RNAP II) contains a remarkable region of tandem heptapeptide repeats of the consensus sequence Tyr-Ser-Pro-Thr-Ser-Pro-Ser at its carboxyl terminus. This COOH-terminal domain (CTD) is unphosphorylated in RNAP IIA, extensively phosphorylated in RNAP IIO, and absent in RNAP IIB. The reversible phosphorylation of the CTD has been proposed to be integral to each cycle of transcription from the adenovirus-2 major late promoter. The adenovirus-2 major late promoter, however, may not be a good paradigm for the study of CTD function because in vitro transcription from this promoter is not dependent on the CTD. Previous studies suggest that transcription from the murine dihydrofolate reductase (DHFR) promoter requires the CTD. In an effort to investigate the role of the CTD and its phosphorylation, a RNAP II-dependent reconstituted transcription system specific for the DHFR promoter was established. In this reconstituted system, RNAP IIA, but not RNAP IIB, can transcribe from the DHFR promoter. Furthermore, RNAP IIB does not compete with RNAP IIA for preinitiation complex assembly. These results suggest that the CTD plays a critical role in the recruitment of RNAP II to the DHFR promoter. The analysis of preinitiation complexes assembled on the DHFR promoter indicates that RNAP IIA readily assembles into functional preinitiation complexes in contrast to the inefficient assembly of RNAP IIO. However, transcript elongation is catalyzed by RNAP IIO as demonstrated by the photoactivated cross-linking of nascent DHFR transcripts to subunit IIo. These results indicate that transcription from the DHFR promoter involves the reversible phosphorylation of the CTD and support the idea that RNAPs IIA and IIO have essential but distinct functions.
...
PMID:RNA polymerases IIA and IIO have distinct roles during transcription from the TATA-less murine dihydrofolate reductase promoter. 822 67


<< Previous 1 2 3 4 Next >>

---