Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:1.14.16.2 (tyrosine hydroxylase)
14,760 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Transcription of tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine biosynthesis, is regulated in a tissue-specific manner. We have identified sequences from -205 to -182 as the minimal enhancer for TH in pheochromocytoma cells using site-directed mutagenesis. This segment (TGATTCAGAGGCAGGTGCCTGTGA) is composed of an AP-1 motif (TGATTCA) and an overlapping 20 bp dyad whose core resembles an E box site (CANNTG). Interaction between the two elements is necessary both in vivo and in vitro: mutation of either element caused a 65%-95% reduction in transcription, and the combination of the two elements conferred cell-specific activation on a heterologous promoter; separation of the two elements by an additional helical turn not only disrupted a DNA-protein complex unique to the two elements, but also abolished expression in vivo. Therefore, we conclude that the interaction between the AP-1 and the E box dyad motifs is responsible for cell-specific TH expression.
...
PMID:Tissue-specific transcription of the rat tyrosine hydroxylase gene requires synergy between an AP-1 motif and an overlapping E box-containing dyad. 135 85

We have previously shown that the phorbol ester, TPA, which activates protein kinase C, causes, in PC12 cells, a transcriptional activation of tyrosine hydroxylase (TH), the key enzyme in catecholamine synthesis. The study has now been extended to examine the processes that underlie this transcriptional stimulation and, in addition, to seek whether similar mechanisms are involved in long-term trans-synaptic induction of the TH gene in adrenal medullae of rats that have been given a single injection of reserpine. In both systems, it was found that the induction of c-fos gene transcription was associated with that of the TH gene but with different kinetics. The promoter of the TH gene contains (at position -207/-200) a sequence (TGATTCA) which differs from the consensus TRE or AP-1 site (TGACTCA) by one nucleotide. Experiments were carried out to investigate whether the AP-1 protein complex which is known to contain Fos and Jun binds to the putative TRE region of the TH promoter. In the gel shift assays, the nuclear protein extracts derived from TPA-treated PC12 cells and from AM of reserpine injected rats displayed a higher magnitude of binding to a 25-mer TRE-TH oligonucleotide as compared to controls. The results showed that the behaviour of TRE-TH was atypical in that two retarded complexes (A and B) were observed, which were displaced by specific competitors. Trans-activation experiments with plasmids TRE-TH/TK/CAT and -754/-19 TH/pUC18-CAT in PC12 cells showed an increase in CAT activity in response to TPA that correlates with the previously observed increase in TH transcriptional activity by TPA.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:AP-1 complex and c-fos transcription are involved in TPA provoked and trans-synaptic inductions of the tyrosine hydroxylase gene: insights into long-term regulatory mechanisms. 138 60

Previously we reported that a single injection of nicotine decreased AP-1 DNA binding activity in adrenal medullae, although chronic bidaily nicotine (and saline) injections increased this binding activity [15]. Repeated acute nicotine injections (3 mg/kg i.p., 7 injections equi-spaced over a 3 h period) effectively increased adrenal tyrosine hydroxylase [3] and [Met5]enkephalin levels and also profoundly decreased adrenal medulla AP-1 DNA binding activity for over 8 h.
...
PMID:Acute repeated nicotine injections increase enkephalin and decrease AP-1 DNA binding activity in rat adrenal medulla. 747 31

Involvement of the IEGs in brain injury and ischemia is under intensive investigation (Gubits et al., 1993). There are several families of the IEGs. They include the fos, jun, and zinc finger genes that encode transcription factors. Products of the fos family (c-fos, fra-1, fra-2, and fos B) bind to members of the jun family (c-jun, jun B, jun D) via leucine zippers, and this dimer then binds to the AP-1 site (consensus sequence -TGACTCA-) in the promoter of target genes, which in turn regulate the expression of late response genes that produce long-term changes in cells. For example, c-fos may regulate the long-term expression of preproenkephalin, nerve growth factor, dynorphin, vasoactive intestinal polypeptide, tyrosine hydroxylase and other genes with AP-1 sites in their promoters (Curran and Morgan, 1987; Sheng and Greenberg, 1990). It is likely that the c-fos gene up-regulation observed in ischemic astrocytes leads to the changes observed in the expressions of hsp and cytoskeleton protein genes in this experimental model. This is supported by the findings of Sarid (1991) and Pennypacker et al. (1994) who have shown that AP-1 DNA binding activity in hippocampus recognized an AP-1 sequence from the promoter region of the GFAP which is a potential target gene. van de Klundert et al. (1992) also suggested the involvement of AP-1 in transcriptional regulation of vimentin. IEGs can be induced within minutes by extracellular stimuli including transmitters, peptides, and growth factors. In this study, we have shown that c-fos induction by ischemia was rapid and transient.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Gene expression in astrocytes during and after ischemia. 756 84

The modulation of neurotransmitter synthesis is a fundamental mechanism influencing neurotransmission and neuronal plasticity during development. The regulation of the tyrosine hydroxylase (TH) has been used to elucidate specific adaptative responses in neurons. Trans-synaptic impulse activity elicits sort- and long-term changes in the activity of TH. Acute regulation involves the activation of preexisting TH molecules via phosphorylation and possibly through alternative splicing events in humans, whereas long-term regulation results from an increased synthesis of the enzyme due in part to the transcriptional stimulation of the TH gene. The long-term increase of TH activity was addressed using the drug reserpine known to modify the secretion of neurotransmitters and the tetradecanoyl phorbol acetate (TPA). Inductions of TH expression by reserpine in vivo as well as by TPA in vitro seem to be mediated by an AP-1 complex acting on a TPA responsive element (TRE) of the rat TH promoter indicating that the TRE-TH site plays a critical role in trans-synaptic induction. Our results also demonstrate a degree of adaption by sympathetic neurons to their environment by conversion from adrenergic to cholinergic phenotype.
...
PMID:Tyrosine hydroxylase regulation in neurotransmission and neuroplasticity. 790 9

Nerve growth factor induces the neuronal-like differentiation of PC12 cells, and epidermal growth factor promotes PC12 viability and is weakly mitogenic. Despite these differences, both growth factors induce indistinguishable patterns of transient delayed transcription of the tyrosine hydroxylase (TH) gene and the expression of proteins encoded by Fos gene family members. Thus, TH expression is sensitive to signaling pathways common to these two growth factors. We show that c-fos and fosB successively occupy an AP-1 site-like element of the TH promoter after nerve growth factor treatment. Furthermore, under conditions of transient transfection, Fos family proteins may synergize with c-jun to transrepress TH gene transcription through the TH-fat-specific element. We show that the target of repression is the AP-1 site-like element that lies within the TH-fat-specific element. We demonstrate that this site is also a major positive acting site for TH control. These results suggest a model in which the long term effect of c-fos family protein expression is to limit the expression of the TH gene. We consider the novel properties of this element in providing temporal and cell type-specific regulation of TH transcription.
...
PMID:Fos family members successively occupy the tyrosine hydroxylase gene AP-1 site after nerve growth factor or epidermal growth factor stimulation and can repress transcription. 790 83

Activation of the tyrosine hydroxylase (TH) gene in the adrenal medulla during stress is mediated by trans-synaptic mechanisms and may involve cholinergic receptors. Stimulation of nicotinic receptors in adrenal medullary cells induces cell depolarization, influx of Ca2+ ions and increases levels of cAMP. We have shown that both cAMP and membrane depolarization produce an increase in the expression of the TH gene in cultured bovine adrenal medullary cells (BAMC). Others have proposed that transcriptional activation of the TH gene by cAMP is mediated through the sequence homologous to a cAMP responsive element (CRE) located in the proximal region of the TH gene promoter. In the present study we have examined the mechanisms by which membrane depolarization increases the TH gene activity. Treatment of serum-free BAMC cultures with the depolarizing agent, veratridine, increased the extracellular concentration of catecholamines, Met5-enkephalin, and the relative abundance of TH mRNA. Veratridine treatment also increased the levels of mRNAs for the catecholamine biosynthetic enzyme phenylethanolamine N-methyltransferase (PNMT), and proenkephalin A (PEK). Treatment for longer than 3 h was required to increase TH mRNA levels. By contrast, our previous studies indicated that cAMP stimulation for 2 h produces a maximal increase in TH mRNA levels in BAMC. The effects of veratridine and forskolin on TH mRNA levels were additive, further indicating that depolarization and cAMP activate TH gene expression via different pathways. Calmidazolium, an antagonist of calmodulin, had no effect on the veratridine-induced increase in TH mRNA levels. Similarly sphingosine treatment or preincubation with PMA, which reduce protein kinase C (PKC) activity and attenuate the induction of TH mRNA by PMA or the hormone, angiotensin II, did not affect the induction by veratridine. To identify promoter mechanisms of TH gene activation in depolarized cells we transfected BAMC with a plasmid pTHgoodLuc and treated with veratridine for 24 h. pTHgoodLUC contains a luciferase reporter gene linked to a -428/+21 bp fragment of the bovine TH gene promoter (relative to the transcription start site). Veratridine increased the expression of luciferase from the TH promoter 2.5-fold. Deletion of the -194/-54 bp promoter region containing SP-1 and POU/Oct sites reduced veratridine stimulation by 40%. Additional deletion of the -269 to -190 bp promoter segment, including an AP-1 element, further reduced veratridine stimulation to a statistically non-significant level. In conclusion, activation of TH gene expression upon depolarization is not mediated by calmodulin and PKC. Promoter sequences involved in this activation are located upstream from the CRE. Depolarization may activate TH gene transcription by acting on more than one regulatory region.
...
PMID:Regulation of tyrosine hydroxylase gene expression in depolarized non-transformed bovine adrenal medullary cells: second messenger systems and promoter mechanisms. 791 5

Stress stimulates the sympathoadrenal system, causing activation of the catecholamine biosynthetic enzymes. Here we examine the changes of gene expression of tyrosine hydroxylase (TH; EC 1.14.16.2), the initial enzyme of catecholamine biosynthesis, with stress. A single immobilization of rats led to a large transient elevation in TH mRNA and a small elevation in TH immunoreactive protein and activity. Repeated daily immobilizations triggered more sustained changes in TH mRNA levels. After two immobilizations, the levels remained elevated even 3 days later. The rise in TH mRNA was followed by increased immunoreactive protein but only a small elevation in activity. With seven repeated immobilizations, the animals did not appear to adapt and still manifested a further rise in TH mRNA. TH activity was markedly elevated and returned to control levels 7 days after the immobilization. The rise in TH mRNA with a single immobilization occurred even in adrenals of hypophysectomized rats that underwent splanchnic nerve section. Immobilization for 30 min was sufficient to increase TH mRNA. The effect was abolished by the transcriptional inhibitor actinomycin D. Mobility gel-shift assays revealed increased binding of c-Fos and c-Jun to the AP-1 transcription factor site after a single immobilization, and the binding was not further elevated with repeated stress. This study shows that a single immobilization can activate TH gene expression by a nonneuronal nonpituitary-mediated pathway associated with increased binding of AP-1 transcription factors.
...
PMID:Induction of tyrosine hydroxylase gene expression by a nonneuronal nonpituitary-mediated mechanism in immobilization stress. 791 37

Odorant deprivation, produced by unilateral naris closure, profoundly reduces tyrosine hydroxylase (TH) expression within intrinsic olfactory bulb dopamine neurons. The TH gene contains an AP-1 site, which interacts with the product of the immediate early gene, c-fos. c-Fos exhibits activity dependent regulation in the CNS. The hypothesis that odorant stimulation and deprivation might modify c-fos expression in TH neurons was tested in adult CD-1 mice, subjected to unilateral naris closure. After 2 months, naris closed and control mice were exposed to either clean air for 60 min or clean air for 60 min followed by 30 min of alternating exposure to 10% isoamyl acetate (1 min) and air (4 min). A parallel reduction occurred in TH and fos expression (both c-fos mRNA and fos-like immunoreactivity) in the glomerular layer of the odorant-deprived olfactory bulb. Odor stimulation induced a short-lived increase in c-fos mRNA and fos-like immunoreactivity in olfactory bulbs contralateral to naris closure. The increase in fos expression was region-specific in the glomerular layer but more diffuse in mitral and granule cell layers. In olfactory bulbs ipsilateral to naris closure, odor stimulation also induced c-fos mRNA expression in the mitral and granule cell layers and sparsely within limited periglomerular regions. Odor induced expression in mitral and granule cell layers may represent increased centrifugal activity acting on as yet unknown genes. These results suggest a correlation between c-fos mRNA expression and increased neuronal activity in the olfactory bulb which, in turn, acts to regulate TH expression in periglomerular neurons.
...
PMID:Regulation of c-Fos mRNA and fos protein expression in olfactory bulbs from unilaterally odor-deprived adult mice. 901 Jul 39

Reserpine treatment leads to a rapid trans-synaptic increase of the tyrosine hydroxylase (TH) gene transcription rate and mRNA levels in catecholaminergic tissues including the adrenal medulla (AM) and the superior cervical ganglia (SCG). In the AM, the formation of a specific protein complex with the TPA-responsive element located in the proximal region of the TH gene was enhanced between 30 min and 8 hr following the injection. This complex appears to contain a member of the Fos family and an antigenically related Jun protein. Moreover, the prolonged and enhanced expression of the c-Fos protein in the AM and its phosphorylation are likely to contribute to the increased TH transcription following reserpine treatment. Most strikingly, in the SCG, the trans-synaptic induction of TH transcription is transduced by totally different mechanisms, since no AP-1 complex and only minute amounts of c-Fos immunoreactivity were detected. Our study provides the first demonstration that, following the same stimulus, the induced expression of a single gene is mediated by different cis- and trans-acting factors in two distinct tissues sharing the same embryonic origin.
...
PMID:AP-1 mediates trans-synaptic induction of tyrosine hydroxylase gene expression in adrenal medulla but not in superior cervical ganglia. 921 May 18


1 2 3 4 Next >>