Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:1.14.16.2 (
tyrosine hydroxylase
)
14,760
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
The mouse
tyrosine hydroxylase
(TH) gene was isolated from a genomic library by cross-hybridization with human TH cDNA probe. Nucleotide sequence analysis of two overlapping genomic clones showed that this gene is split into 13 exons distributed about 7.5 kb in length. The transcription initiation site was determined by primer extension analysis with mouse adrenal gland poly(A)+RNA. The structure of the mouse TH gene was similar to that of the human TH gene, but it contained neither the alternative splice donor site around the 3'-end of the first exon nor an independent exon corresponding to the second exon of the human TH gene. There were the canonical TATA and GC boxes, cyclic AMP responsive element (CRE), and
AP1
binding site in the 5'-flanking region of the mouse TH gene.
...
PMID:Structure of the mouse tyrosine hydroxylase gene. 134 48
Investigation of neuroendocrine genes has revealed that transcription is regulated via multiple DNA binding sites, including the cyclic AMP response element (CRE). We show here that for the neuronal and chromaffin-specific gene
tyrosine hydroxylase
(TH), a 70-bp region (-229 to -160) lacking the CRE is sufficient, in either orientation, to confer levels of chloramphenicol acetyltransferase reporter expression equivalent to or greater than that conferred by 4.8 kb of the rat TH enhancer/promoter region. The 70-bp region contains potential binding sites for AP2,
AP1
, E2A/MyoD, and POU transcription factors, and functions when linked to the TH promoter, but not when joined to a heterologous RSV promoter. This demonstrates that promoter as well as enhancer elements are important for TH expression. In gel-shift assays, the 70-bp fragment forms a cell type-specific complex with nuclear extracts from TH-expressing cells. which is effectively competed by an oligonucleotide containing AP2,
AP1
, and E2A/MyoD (E box) sites, but not by one containing the POU site. These data suggest that the AP2,
AP1
, and/or E box sites may be involved in forming the cell-specific complex. Although it lacks an authentic CRE, the 70-bp region also mediated a twofold transcriptional response to forskolin, equivalent to that found with the endogenous gene. A different region (-60 to -29) bearing a consensus CRE mediated a sixfold increase in transcription in response to forskolin, but only minimally activated basal transcription from the TH promoter in the absence of forskolin.
...
PMID:Sequences that direct rat tyrosine hydroxylase gene expression. 134 42
It is well documented that cold stress induces a rapid trans-synaptically mediated increase in the relative abundance of rat adrenomedullary
tyrosine hydroxylase
(TH) mRNA. To investigate the transcriptional mechanisms regulating the cold stress response, we have employed a gel mobility shift assay, using DNA fragments prepared from the proximal 5' flanking region of the bovine TH gene as a heterologous molecular probe. In pilot studies, this region of the bovine TH promoter (nucleotides -246 to +21) was fused to the bacterial reporter gene, chloramphenicol acetyltransferase, and the chimeric construct transfected into human neuroblastoma SK-N-BE(2)-C, hepatoma HepG2, and rat pheochromocytoma PC-12 cells. Results of this analysis indicate that the proximal 5' flanking region of the bovine TH gene contains sufficient information to drive transient reporter gene expression in both human and rat catecholaminergic clonal cell lines. The findings derived from the gel mobility shift studies demonstrate that cold exposure causes rapid and selective alterations in the binding of adrenomedullary nuclear proteins to the proximal 5' flanking region of the TH gene. The most striking cold stress-induced alteration in DNA/nucleoprotein binding occurs in a region of the TH promoter (nucleotides -246 to -189) which contains an element bearing marked sequence similarity to an
AP1
binding site and is highly conserved among animal species. This alteration occurs within 1 hr of cold exposure and persists for up to 48 hr after the onset of stress. The results of adrenal denervation experiments indicate that the cold-induced change in DNA/nucleoprotein binding is neurally mediated, requiring intact sympathetic innervation of the gland.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Cold-induced alterations in the binding of adrenomedullary nuclear proteins to the promoter region of the tyrosine hydroxylase gene. 136 May 41
A human genomic clone encompassing exons 1-3 of the neurotensin/neuromedin N gene was identified using a canine neurotensin complementary DNA probe. Sequence comparisons revealed that the 120-amino acid portion of the precursor sequence encoded by exons 1-3 is 89% identical to previously determined cow and dog sequences and that the proximal 250 bp of 5' flanking sequences are strikingly conserved between rat and human. The 5' flanking sequence contains cis-regulatory sites required for the induction of neurotensin/neuromedin N gene expression in PC12 cells, including
AP1
sites and two cyclic adenosine-5'-monophosphate response elements. Oligonucleotide probes based on the human sequence were used to examine the distribution of neurotensin/neuromedin N messenger RNA in the ventral mesencephalon of schizophrenics and age- and sex-matched controls. Neurotensin/neuromedin N messenger RNA was observed in ventral mesencephalic cells some of which also contained melanin pigment or
tyrosine hydroxylase
messenger RNA. Neurons expressing neurotensin/neuromedin N messenger RNA were observed in the ventral mesencephalon of both schizophrenic and non-schizophrenic humans.
...
PMID:Cloning of human neurotensin/neuromedin N genomic sequences and expression in the ventral mesencephalon of schizophrenics and age/sex matched controls. 143 92
Preganglionic nerve stimulation has been shown to induce delayed or long term changes in the neuron. Different models were used to study the trans-synaptic regulation of the
tyrosine hydroxylase
(TH): the rat adrenal medulla (AM) and the superior cervical ganglia (SCG). Northern blot analysis, western blot and enzymatic assays demonstrated that the TH mRNA paralleled both an increase in the protein amount and its enzymatic activity. Results of in vitro transcription on nuclei isolated from AM or from SCG after treatment with reserpine suggest that this increase in TH expression is due to an effect on the transcriptional activity of the TH gene. Other gene, cfos, is also induced by reserpine indicating that the TH transcription in these neurons may be mediated by "third messengers". Several putative regulatory elements, in particular an octamer sequence
AP1
has been localized in the promoter of TH gene. Gel shift assays with nuclear extracts from untreated and phorbol ester treated cells strongly suggest that a protein complex binds to this
AP1
like sequence. Comparative analysis of gel shift assays with AM nuclear extracts exhibit a similar pattern suggesting that this
AP1
site could be involved in the trans-synaptic regulation of TH.
...
PMID:In vitro and in vivo regulation of the expression of the tyrosine hydroxylase gene. 168 22
We reported recently that the gene that encodes
tyrosine hydroxylase
(TH), the rate-limiting enzyme in the biosynthesis of catecholamines, is regulated by hypoxia in the dopaminergic cells of the mammalian carotid body (Czyzyk-Krzeska, M. F., Bayliss, D. A., Lawson, E. E. & Millhorn, D. E. (1992) J. Neurochem. 58, 1538-1546) and in pheochromocytoma (PC12) cells (Czyzyk-Krzeska, M. F., Furnari, B. A., Lawson, E. E. & Millhorn, D. E. (1994) J. Biol. Chem. 269, 760-764). Regulation of this gene during low O2 conditions occurs at both the level of transcription and RNA stability. Increased transcription during hypoxia is regulated by a region of the proximal promoter that extends from -284 to + 27 bases, relative to transcription start site. The present study was undertaken to further characterize the sequences that confer O2 responsiveness of the TH gene and to identify hypoxia-induced protein interactions with these sequences. Results from chloramphenicol acetyltransferase assays identified a region between bases -284 and -150 that contains the essential sequences for O2 regulation. This region contains a number of regulatory elements including
AP1
, AP2, and HIF-1. Gel shift assays revealed enhanced protein interactions at the
AP1
and HIF-1 elements of the native gene. Further investigations using supershift and shift-Western analysis showed that c-Fos and JunB bind to the
AP1
element during hypoxia and that these protein levels are stimulated by hypoxia. Mutation of the
AP1
sequence prevented stimulation of transcription of the TH-chloramphenicol acetyltransferase reporter gene by hypoxia.
...
PMID:Hypoxia-induced protein binding to O2-responsive sequences on the tyrosine hydroxylase gene. 755 51
Enhancer elements regulating the neuronal gene,
tyrosine hydroxylase
(TH), were identified in TH-expressing peripheral nervous system PATH and central nervous system CATH cell lines. Mutational analysis in which rat TH 5'-flanking sequences directed chloramphenicol acetyltransferase (CAT) reporter gene expression demonstrated that mutating the cyclic AMP response element (CRE) at -45 base pair reduced expression by 80-90%. A CRE linked to an enhancerless TH promoter fully supported expression. Cotransfection of a dominant-negative CREB protein reduced expression 50-60%, suggesting that the CRE is bound by CREB or a CREB dimerization partner. Although mutating the
AP1
/dyad (AD) element at -205 base pair only modestly reduced CAT levels, AD minimal enhancer constructs gave 45-80% of wild type expression when positioned at -91 or -95. However, in its native context at -205, the AD could not support expression. In contrast, a CRE, moved from its normal position at -45 to -206, gave full activity. These results indicate that the CRE is critical for TH transcription in central nervous system CATH and peripheral nervous system PATH cells, whereas the AD is less important and its enhancer activity is context-and/or position-dependent. These results represent the first attempts to map regulatory elements directing TH expression in central nervous system cell lines.
...
PMID:The cyclic AMP response element directs tyrosine hydroxylase expression in catecholaminergic central and peripheral nervous system cell lines from transgenic mice. 766 71
The enhancer of the rat
tyrosine hydroxylase
gene (TH) in PC8b cells is composed of the
AP1
motif (TCATTCA, -205 to -199) and an overlapping 20-base pair dyad symmetry element (TCAGAGGCAGGTGCCTGTGA, -201 to -182) whose core is an E-box. We have isolated two partial cDNA clones that encode factors which bind the TH-dyad. One is rITF2 with a basic helix-loop-helix motif and the other is CDP2 with a homeodomain. rITF2 is a rat homolog of human ITF2 (or E2-2), and CDP2 is a member of a new family of homeoproteins defined by histidine as the 9th residue of the recognition helix and by unique 64 amino acid repeats related to those of the Drosophila cut gene. The binding affinity of CDP2 alone is relatively weak, but it enhances the binding of rITF2 to the TH-dyad. In transfected F9 cells, activation of a TH-driven reporter requires both rITF2 and CDP2, suggesting that the proteins may functionally interact. However, rITF2 and CDP2 are not restricted to TH-expressing tissues; hence they may not be involved in the tissue-specific expression of TH. In addition, CDP2 is phosphorylated in vitro and in vivo.
...
PMID:Isolation of two E-box binding factors that interact with the rat tyrosine hydroxylase enhancer. 791 62
bFGF is a neurotrophic protein expressed in various regions of the adult peripheral and central nervous system. The present study was undertaken to examine the role of bFGF in multihormonal, catecholaminergic and enkephalinergic cells of the adrenal medulla (AM). Western blot analysis revealed the presence of at least three bFGF isoforms (18, 22/23, and 24 kDa) in cultured bovine AM cells. Incubation of AM cells with the exogenous 18 kDa bFGF produced time-dependent increases in
tyrosine hydroxylase
(TH) and proenkephalin (PEK) mRNA, with maximal changes occurring at 12 h (TH) or 24 h (PEK) of bFGF exposure. Effects of bFGF on TH and PEK mRNA were non-additive with increases induced by exposure of AM cells to nicotine, the depolarizing agent veratridine, or the adenylate cyclase activator forskolin. These data indicate that bFGF effects may occur through intracellular pathways accessed during transsynaptic induction of TH and PEK genes. The increases in PEK mRNA induced by nicotine or bFGF were inhibited by the calcium antagonist TMB-8. TMB-8 also inhibited bFGF-induced increases in TH mRNA as well. However, treatment with TMB-8 increased basal levels of TH mRNA. The addition of bFGF increased endogenous levels of c-fos mRNA, c-Fos and c-Fos-related proteins, suggesting that bFGF may activate TH and PEK gene expression through a calcium-
AP1
transcriptional regulatory pathway. Immunohistochemical analysis revealed the presence of bFGF-immunoreactivity (bFGF-IR) in the cytoplasm and in the nucleus of AM cells. Incubation of cells with exogenous bFGF produced time-dependent increases of nuclear bFGF-IR.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Basic fibroblast growth factor (bFGF) regulates tyrosine hydroxylase and proenkephalin mRNA levels in adrenal chromaffin cells. 810 Jan 72
The cAMP response element (CRE) mediates cAMP responsiveness in many eukaryotic genes (Roesler, W. J., Vandenbark, G. R., and Hansen, R. W. (1988) J. Biol. Chem. 263, 9063-9066). The
tyrosine hydroxylase
gene (TH) contains a single copy of a consensus CRE at -45 to -38 base pair (bp) upstream of the transcription initiation site. Deletional and mutational analyses of the upstream 2400-base pair region of the rat TH gene using transient transfection assay demonstrated that the CRE was essential for both cAMP-mediated induction and basal transcription of the TH gene. Another domain between -365 and -151 bp, containing the
AP1
site, contributed to transcription to a smaller degree. Thus, the CRE appears to play an important dual role as a basal promoter element and an inducible enhancer for TH transcription. Interactions between the DNA binding factors in nuclear extract and CRE-containing oligonucleotides were investigated by gel retardation and competition assays. Oligonucleotides corresponding to the CRE regions of the TH or somatostatin gene gave rise to a pair of distinct protein-DNA complexes with identical mobilities in the gel retardation assay, suggesting that similar nuclear factor(s) might bind to the CREs of the TH and somatostatin genes. This study emphasizes a fundamental role of the CRE in transcriptional activation of the TH gene in catecholaminergic cells.
...
PMID:Both the basal and inducible transcription of the tyrosine hydroxylase gene are dependent upon a cAMP response element. 810 43
1
2
3
Next >>